A2BP1 | GeneID:54715 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 54715 Official Symbol A2BP1
Locus N/A Gene Type protein-coding
Synonyms FOX1; HRNBP1
Full Name N/A
Description ataxin 2-binding protein 1
Chromosome 16p13.3
Also Known As hexaribonucleotide binding protein 1
Summary Ataxin-2 binding protein 1 has an RNP motif that is highly conserved among RNA-binding proteins. This protein binds to the C-terminus of ataxin-2 and may contribute to the restricted pathology of spinocerebellar ataxia type 2 (SCA2). Ataxin-2 is the gene product of the SCA2 gene which causes familial neurodegenerative diseases. Ataxin-2 binding protein 1 and ataxin-2 are both localized in the trans-Golgi network. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. Additional transcript variants have been found but their full length nature has not been determined. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 69339

ID Symbol Protein Species
GeneID:54715 A2BP1 NP_665898.1 Homo sapiens
GeneID:268859 A2bp1 NP_899011.1 Mus musculus
GeneID:302920 A2bp1 XP_220155.3 Rattus norvegicus
GeneID:416645 A2BP1 XP_414942.2 Gallus gallus
GeneID:449554 a2bp1 NP_001005596.1 Danio rerio
GeneID:609116 LOC609116 XP_851461.1 Canis lupus familiaris

Exon, Intron and UTRs

Exon, Intron and UTRs of A2BP1 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of A2BP1 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0005634 Component nucleus
GO:0005802 Component trans-Golgi network
GO:0000166 Function nucleotide binding
GO:0008022 Function protein C-terminus binding
GO:0003723 Function RNA binding
GO:0006397 Process mRNA processing
GO:0008380 Process RNA splicing
GO:0050658 Process RNA transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001142333  UCSC Browser NP_001135805
2 NM_001142334  UCSC Browser NP_001135806
3 NM_018723  UCSC Browser NP_061193 Q59HD3   Q9NWB1  
4 NM_145891  UCSC Browser NP_665898
5 NM_145892  UCSC Browser NP_665899
6 NM_145893  UCSC Browser NP_665900

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000311745 MI0004998 gga-miR-460 CCUGCAUUGUACACACUGUGUG
ENST00000311745 MI0000469 hsa-miR-125a-5p UCCCUGAGACCCUUUAACCUGUGA
ENST00000311745 MI0000342 hsa-miR-200b UAAUACUGCCUGGUAAUGAUGA
ENST00000311745 MI0000650 hsa-miR-200c UAAUACUGCCGGGUAAUGAUGGA
ENST00000311745 MI0003130 hsa-miR-202 AGAGGUAUAGGGCAUGGGAA
ENST00000311745 MI0000777 hsa-miR-369-5p AGAUCGACCGUGUUAUAUUCGC
ENST00000311745 MI0001641 hsa-miR-429 UAAUACUGUCUGGUAAAACCGU
ENST00000311745 MI0003649 hsa-miR-634 AACCAGCACCCCAACUUUGGAC
ENST00000311745 MI0002406 mmu-miR-471 UACGUAGUAUAGUGCUUUUCAC
ENST00000311745 MI0004687 mmu-miR-703 AAAACCUUCAGAAGGAAAGAA
ENST00000340209 MI0003593 hsa-miR-548a-3p CAAAACUGGCAAUUACUUUUGC
ENST00000340209 MI0003598 hsa-miR-548a-3p CAAAACUGGCAAUUACUUUUGC
ENST00000340209 MI0003612 hsa-miR-548a-3p CAAAACUGGCAAUUACUUUUGC
ENST00000355637 MI0000650 hsa-miR-200c UAAUACUGCCGGGUAAUGAUGGA
ENST00000355637 MI0002406 mmu-miR-471 UACGUAGUAUAGUGCUUUUCAC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Autistic Disorder marker 18621663

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Ollila HM, et al. (2009) "Findings from bipolar disorder genome-wide association studies replicate in a Finnish bipolar family-cohort." Mol Psychiatry. 14(4):351-353. PMID:19308021
  2. [ + ] Huang YT, et al. (2009) "Genome-wide analysis of survival in early-stage non-small-cell lung cancer." J Clin Oncol. 27(16):2660-2667. PMID:19414679
  3. [ + ] Uhl GR, et al. (2008) "Molecular genetics of successful smoking cessation: convergent genome-wide association study results." Arch Gen Psychiatry. 65(6):683-693. PMID:18519826
  4. [ + ] Zhou HL, et al. (2008) "Repression of prespliceosome complex formation at two distinct steps by Fox-1/Fox-2 proteins." Mol Cell Biol. 28(17):5507-5516. PMID:18573872
  5. [ + ] Zhang C, et al. (2008) "Defining the regulatory network of the tissue-specific splicing factors Fox-1 and Fox-2." Genes Dev. 22(18):2550-2563. PMID:18794351
  6. [ + ] Sonuga-Barke EJ, et al. (2008) "Does parental expressed emotion moderate genetic effects in ADHD? An exploration using a genome wide association scan." Am J Med Genet B Neuropsychiatr Genet. 147B(8):1359-1368. PMID:18846501
  7. [ + ] Anney RJ, et al. (2008) "Conduct disorder and ADHD: evaluation of conduct problems as a categorical and quantitative trait in the international multicentre ADHD genetics study." Am J Med Genet B Neuropsychiatr Genet. 147B(8):1369-1378. PMID:18951430
  8. [ + ] Castle JC, et al. (2008) "Expression of 24,426 human alternative splicing events and predicted cis regulation in 48 tissues and cell lines." Nat Genet. 40(12):1416-1425. PMID:18978788
  9. [ + ] Gieger C, et al. (2008) "Genetics meets metabolomics: a genome-wide association study of metabolite profiles in human serum." PLoS Genet. 4(11):e1000282. PMID:19043545
  10. [ + ] Zhou HL, et al. (2007) "Role for Fox-1/Fox-2 in mediating the neuronal pathway of calcitonin/calcitonin gene-related peptide alternative RNA processing." Mol Cell Biol. 27(3):830-841. PMID:17101796
  11. [ + ] Martin CL, et al. (2007) "Cytogenetic and molecular characterization of A2BP1/FOX1 as a candidate gene for autism." Am J Med Genet B Neuropsychiatr Genet. 144B(7):869-876. PMID:17503474
  12. [ + ] Auweter SD, et al. (2006) "Molecular basis of RNA recognition by the human alternative splicing factor Fox-1." EMBO J. 25(1):163-173. PMID:16362037
  13. [ + ] Ponthier JL, et al. (2006) "Fox-2 splicing factor binds to a conserved intron motif to promote inclusion of protein 4.1R alternative exon 16." J Biol Chem. 281(18):12468-12474. PMID:16537540
  14. [ + ] Lim J, et al. (2006) "A protein-protein interaction network for human inherited ataxias and disorders of Purkinje cell degeneration." Cell. 125(4):801-814. PMID:16713569
  15. [ + ] Underwood JG, et al. (2005) "Homologues of the Caenorhabditis elegans Fox-1 protein are neuronal splicing regulators in mammals." Mol Cell Biol. 25(22):10005-10016. PMID:16260614
  16. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  17. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  18. [ + ] Kiehl TR, et al. (2001) "Identification and expression of a mouse ortholog of A2BP1." Mamm Genome. 12(8):595-601. PMID:11471052
  19. [ + ] Shibata H, et al. (2000) "A novel protein with RNA-binding motifs interacts with ataxin-2." Hum Mol Genet. 9(9):1303-1313. PMID:10814712