A4GNT | GeneID:540795 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 540795 Official Symbol A4GNT
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description alpha-1,4-N-acetylglucosaminyltransferase
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 87446

ID Symbol Protein Species
GeneID:51146 A4GNT NP_057245.1 Homo sapiens
GeneID:333424 A4gnt NP_001070892.1 Mus musculus
GeneID:429136 A4GNT XP_426692.2 Gallus gallus
GeneID:460724 A4GNT XP_516775.2 Pan troglodytes
GeneID:485683 A4GNT XP_542803.2 Canis lupus familiaris
GeneID:540795 A4GNT XP_613170.1 Bos taurus
GeneID:685758 A4gnt XP_001065156.1 Rattus norvegicus

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_613170 XP_613170

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000001899 MI0000452 hsa-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
ENSBTAT00000001899 MI0000453 hsa-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
ENSBTAT00000001899 MI0000262 hsa-miR-147 GUGUGUGGAAAUGCUUCUGC
ENSBTAT00000001899 MI0000740 hsa-miR-219-2-3p AGAAUUGUGGCUGGACAUCUGU
ENSBTAT00000001899 MI0000814 hsa-miR-338-5p AACAAUAUCCUGGUGCUGAGUG
ENSBTAT00000001899 MI0003599 hsa-miR-589 UGAGAACCACGUCUGCUCUGAG
ENSBTAT00000001899 MI0003649 hsa-miR-634 AACCAGCACCCCAACUUUGGAC
ENSBTAT00000001899 MI0005541 hsa-miR-875-5p UAUACCUCAGUUUUAUCAGGUG
ENSBTAT00000001899 MI0005542 hsa-miR-876-3p UGGUGGUUUACAAAGUAAUUCA
ENSBTAT00000001899 MI0000390 mmu-miR-292-3p AAAGUGCCGCCAGGUUUUGAGUGU
ENSBTAT00000001899 MI0005511 mmu-miR-466h UGUGUGCAUGUGCUUGUGUGUA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_613170  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]