A4GALT | GeneID:53947 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 53947 Official Symbol A4GALT
Locus N/A Gene Type protein-coding
Synonyms A14GALT; A4GALT1; P1; PK
Full Name alpha 1,4-galactosyltransferase
Description alpha 1,4-galactosyltransferase
Chromosome 22q11.2-q13.2
Also Known As CD77 synthase; GB3 synthase; P blood group (P one antigen); P(k) antigen synthase; P1/Pk synthase; UDP-galactose:beta-D-galactosyl-beta1-R 4-alpha-D-galactosyltransferase; alpha-1,4-N-acetylglucosaminyltransferase; alpha4Gal-T1; globotriaosylceramide synthase; lactosylceramide 4-alpha-galactosyltransferase
Summary The protein encoded by this gene catalyzes the transfer of galactose to lactosylceramide to form globotriaosylceramide, which has been identified as the P(k) antigen of the P blood group system. The encoded protein, which is a type II membrane protein found in the Golgi, is also required for the synthesis of the bacterial verotoxins receptor. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 9690

ID Symbol Protein Species
GeneID:33512 alpha4GT1 NP_608737.1 Drosophila melanogaster
GeneID:43124 alpha4GT2 NP_651434.2 Drosophila melanogaster
GeneID:53947 A4GALT NP_059132.1 Homo sapiens
GeneID:63888 A4galt NP_071576.1 Rattus norvegicus
GeneID:239559 A4galt NP_001004150.1 Mus musculus
GeneID:418223 A4GALT XP_416448.2 Gallus gallus
GeneID:470230 A4GALT NP_001009123.1 Pan troglodytes
GeneID:481222 A4GALT XP_538343.2 Canis lupus familiaris
GeneID:1277725 AgaP_AGAP008258 XP_317211.2 Anopheles gambiae
GeneID:3291688 AgaP_AGAP008260 XP_555205.1 Anopheles gambiae

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab19795 CD77 antibody [38-13] (ab19795); Rat monoclonal [38-13] to CD77
2 abnova H00053947-M08 A4GALT monoclonal antibody (M08), clone 3E12; Mouse monoclonal antibody raised against a partial recombinant A4GALT.
3 acris SM1160P CD77 / A4GALT; antibody Ab
4 scbt A4GALT A4GALT Antibody / A4GALT Antibodies;
5 sigma HPA001141 Anti-A4GALT antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of A4GALT Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of A4GALT Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005794 Component Golgi apparatus
GO:0000139 Component Golgi membrane
GO:0005795 Component Golgi stack
GO:0030173 Component integral to Golgi membrane
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0005624 Component membrane fraction
GO:0008378 Function galactosyltransferase activity
GO:0050512 Function lactosylceramide 4-alpha-galactosyltransferase activity
GO:0016757 Function transferase activity, transferring glycosyl groups
GO:0006688 Process glycosphingolipid biosynthetic process
GO:0008610 Process lipid biosynthetic process
GO:0007009 Process plasma membrane organization

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_017436  UCSC Browser NP_059132 B2R7C4   Q9NPC4  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000249005 MI0000482 hsa-miR-185* AGGGGCUGGCUUUCCUCUGGUC
ENST00000249005 MI0000072 hsa-miR-18a* ACUGCCCUAAGUGCUCCUUCUGG
ENST00000249005 MI0001518 hsa-miR-18b* UGCCCUAAAUGCCCCUUCUGGC
ENST00000249005 MI0000806 hsa-miR-337-5p GAACGGCUUCAUACAGGAGUU
ENST00000249005 MI0003646 hsa-miR-33b* CAGUGCCUCGGCAGUGCAGCCC
ENST00000249005 MI0003180 hsa-miR-516a-5p UUCUCGAGGAAAGAAGCACUUUC
ENST00000249005 MI0003181 hsa-miR-516a-5p UUCUCGAGGAAAGAAGCACUUUC
ENST00000249005 MI0003167 hsa-miR-516b AUCUGGAGGUAAGAAGCACUUU
ENST00000249005 MI0003172 hsa-miR-516b AUCUGGAGGUAAGAAGCACUUU
ENST00000249005 MI0003159 hsa-miR-518c* UCUCUGGAGGGAAGCACUUUCUG
ENST00000249005 MI0003149 hsa-miR-520a-3p AAAGUGCUUCCCUUUGGACUGU
ENST00000249005 MI0003164 hsa-miR-520d-3p AAAGUGCUUCUCUUUGGUGGGU
ENST00000249005 MI0003572 hsa-miR-566 GGGCGCCUGUGAUCCCAAC
ENST00000249005 MI0003660 hsa-miR-645 UCUAGGCUGGUACUGCUGA
ENST00000249005 MI0000643 mmu-miR-351 UCCCUGAGGAGCCCUUUGAGCCUG
ENST00000249005 MI0000636 rno-miR-349 CAGCCCUGCUGUCUUAACCUCU
ENST00000381276 MI0000482 hsa-miR-185* AGGGGCUGGCUUUCCUCUGGUC
ENST00000381276 MI0000806 hsa-miR-337-5p GAACGGCUUCAUACAGGAGUU
ENST00000381276 MI0003180 hsa-miR-516a-5p UUCUCGAGGAAAGAAGCACUUUC
ENST00000381276 MI0003181 hsa-miR-516a-5p UUCUCGAGGAAAGAAGCACUUUC
ENST00000381276 MI0003167 hsa-miR-516b AUCUGGAGGUAAGAAGCACUUU
ENST00000381276 MI0003172 hsa-miR-516b AUCUGGAGGUAAGAAGCACUUU
ENST00000381276 MI0003149 hsa-miR-520a-3p AAAGUGCUUCCCUUUGGACUGU
ENST00000381276 MI0003164 hsa-miR-520d-3p AAAGUGCUUCUCUUUGGUGGGU
ENST00000381276 MI0003572 hsa-miR-566 GGGCGCCUGUGAUCCCAAC
ENST00000381276 MI0003660 hsa-miR-645 UCUAGGCUGGUACUGCUGA
ENST00000381276 MI0000643 mmu-miR-351 UCCCUGAGGAGCCCUUUGAGCCUG
ENST00000381276 MI0004553 mmu-miR-666-5p AGCGGGCACAGCUGUGAGAGCC
ENST00000381278 MI0000450 hsa-miR-133a UUUGGUCCCCUUCAACCAGCUG
ENST00000381278 MI0000451 hsa-miR-133a UUUGGUCCCCUUCAACCAGCUG
ENST00000381278 MI0000822 hsa-miR-133b UUUGGUCCCCUUCAACCAGCUA
ENST00000381278 MI0000482 hsa-miR-185* AGGGGCUGGCUUUCCUCUGGUC
ENST00000381278 MI0000239 hsa-miR-197 UUCACCACCUUCUCCACCCAGC
ENST00000381278 MI0000288 hsa-miR-212 UAACAGUCUCCAGUCACGGCC
ENST00000381278 MI0000301 hsa-miR-224 CAAGUCACUAGUGGUUCCGUU
ENST00000381278 MI0000806 hsa-miR-337-5p GAACGGCUUCAUACAGGAGUU
ENST00000381278 MI0000743 hsa-miR-34c-3p AAUCACUAACCACACGGCCAGG
ENST00000381278 MI0000760 hsa-miR-361-3p UCCCCCAGGUGUGAUUCUGAUUU
ENST00000381278 MI0002464 hsa-miR-412 ACUUCACCUGGUCCACUAGCCGU
ENST00000381278 MI0002468 hsa-miR-484 UCAGGCUCAGUCCCCUCCCGAU
ENST00000381278 MI0003149 hsa-miR-520a-3p AAAGUGCUUCCCUUUGGACUGU
ENST00000381278 MI0003164 hsa-miR-520d-3p AAAGUGCUUCUCUUUGGUGGGU
ENST00000381278 MI0003163 hsa-miR-521 AACGCACUUCCCUUUAGAGUGU
ENST00000381278 MI0003176 hsa-miR-521 AACGCACUUCCCUUUAGAGUGU
ENST00000381278 MI0003153 hsa-miR-523 GAACGCGCUUCCCUAUAGAGGGU
ENST00000381278 MI0003572 hsa-miR-566 GGGCGCCUGUGAUCCCAAC
ENST00000381278 MI0003641 hsa-miR-627 GUGAGUCUCUAAGAAAAGAGGA
ENST00000381278 MI0003660 hsa-miR-645 UCUAGGCUGGUACUGCUGA
ENST00000381278 MI0004601 mmu-miR-673-5p CUCACAGCUCUGGUCCUUGGAG
ENST00000381278 MI0004640 mmu-miR-680 GGGCAUCUGCUGACAUGGGGG
ENST00000381278 MI0004641 mmu-miR-680 GGGCAUCUGCUGACAUGGGGG
ENST00000381278 MI0004642 mmu-miR-680 GGGCAUCUGCUGACAUGGGGG
ENST00000381278 MI0004678 mmu-miR-720 AUCUCGCUGGGGCCUCCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

AAH17068   AAH55286   AAO39149   AAO39150   AAO39151   AAP47164   AAP47167   AAP47168   AAQ68076   AAS77214   AAS77215   AAS77216   AAX20109   ABM82545   ABM85737   BAA94503   BAA95915   BAG35771   CAB93532   CAI18757   EAW73274   NP_059132   Q540I5   Q540I6   Q5D079   Q6RJV9   Q6RJW0   Q6RJW1   Q7Z2I1   Q7Z7C6   Q9NPC4  

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Lund N, et al. (2009) "The human P(k) histo-blood group antigen provides protection against HIV-1 infection." Blood. 113(20):4980-4991. PMID:19139081
  2. [ + ] Hellberg A, et al. (2008) "Expression of a novel missense mutation found in the A4GALT gene of Amish individuals with the p phenotype." Transfusion. 48(3):479-487. PMID:18067504
  3. [ + ] Okuda T, et al. (2008) "Identification and characterization of the human Gb3/CD77 synthase gene promoter." Glycobiology. 18(12):1028-1035. PMID:18757779
  4. [ + ] Hellberg A, et al. (2005) "Two previously proposed P1/P2-differentiating and nine novel polymorphisms at the A4GALT (Pk) locus do not correlate with the presence of the P1 blood group antigen." BMC Genet. 6():49. PMID:16212661
  5. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  6. [ + ] Hellberg A, et al. (2004) "Genetic heterogeneity at the glycosyltransferase loci underlying the GLOB blood group system and collection." Br J Haematol. 125(4):528-536. PMID:15142124
  7. [ + ] Iwamura K, et al. (2003) "The blood group P1 synthase gene is identical to the Gb3/CD77 synthase gene. A clue to the solution of the P1/P2/p puzzle." J Biol Chem. 278(45):44429-44438. PMID:12888565
  8. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  9. [ + ] Furukawa K, et al. (2002) "Expression of the Gb3/CD77 synthase gene in megakaryoblastic leukemia cells: implication in the sensitivity to verotoxins." J Biol Chem. 277(13):11247-11254. PMID:11782470
  10. [ + ] Koda Y, et al. (2002) "Three-base deletion and one-base insertion of the alpha(1,4)galactosyltransferase gene responsible for the P phenotype." Transfusion. 42(1):48-51. PMID:11896312
  11. [ + ] Furukawa K, et al. (2000) "Molecular basis for the p phenotype. Identification of distinct and multiple mutations in the alpha 1,4-galactosyltransferase gene in Swedish and Japanese individuals." J Biol Chem. 275(48):37752-37756. PMID:10993874
  12. [ + ] Keusch JJ, et al. (2000) "Cloning of Gb3 synthase, the key enzyme in globo-series glycosphingolipid synthesis, predicts a family of alpha 1, 4-glycosyltransferases conserved in plants, insects, and mammals." J Biol Chem. 275(33):25315-25321. PMID:10854428
  13. [ + ] Kojima Y, et al. (2000) "Molecular cloning of globotriaosylceramide/CD77 synthase, a glycosyltransferase that initiates the synthesis of globo series glycosphingolipids." J Biol Chem. 275(20):15152-15156. PMID:10748143
  14. [ + ] Steffensen R, et al. (2000) "Cloning and expression of the histo-blood group Pk UDP-galactose: Ga1beta-4G1cbeta1-cer alpha1, 4-galactosyltransferase. Molecular genetic basis of the p phenotype." J Biol Chem. 275(22):16723-16729. PMID:10747952
  15. [ + ] Dunham I, et al. (1999) "The DNA sequence of human chromosome 22." Nature. 402(6761):489-495. PMID:10591208