ABCC8 | GeneID:538996 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 538996 Official Symbol ABCC8
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family C (CFTR/MRP), member 8
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 68048

ID Symbol Protein Species
GeneID:6833 ABCC8 NP_000343.2 Homo sapiens
GeneID:20927 Abcc8 NP_035640.2 Mus musculus
GeneID:25559 Abcc8 NP_037171.1 Rattus norvegicus
GeneID:423072 ABCC8 XP_421005.2 Gallus gallus
GeneID:451056 ABCC8 XP_508310.2 Pan troglodytes
GeneID:485402 ABCC8 XP_542520.2 Canis lupus familiaris
GeneID:538996 ABCC8 XP_584132.3 Bos taurus
GeneID:553281 abcc8 XP_001920483.1 Danio rerio

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_584132 XP_584132

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000046676 MI0000273 hsa-miR-183 UAUGGCACUGGUAGAAUUCACU
ENSBTAT00000046676 MI0005569 hsa-miR-216b AAAUCUCUGCAGGCAAAUGUGA
ENSBTAT00000046676 MI0000744 hsa-miR-299-5p UGGUUUACCGUCCCACAUACAU
ENSBTAT00000046676 MI0000775 hsa-miR-367 AAUUGCACUUUAGCAAUGGUGA
ENSBTAT00000046676 MI0003557 hsa-miR-552 AACAGGUGACUGGUUAGACAA
ENSBTAT00000046676 MI0003589 hsa-miR-582-5p UUACAGUUGUUCAACCAGUUACU
ENSBTAT00000046676 MI0003621 hsa-miR-608 AGGGGUGGUGUUGGGACAGCUCCGU
ENSBTAT00000046676 MI0003643 hsa-miR-629 UGGGUUUACGUUGGGAGAACU
ENSBTAT00000046676 MI0003650 hsa-miR-635 ACUUGGGCACUGAAACAAUGUCC
ENSBTAT00000046676 MI0003667 hsa-miR-652 AAUGGCGCCACUAGGGUUGUG
ENSBTAT00000046676 MI0003672 hsa-miR-663 AGGCGGGGCGCCGCGGGACCGC
ENSBTAT00000046676 MI0003760 hsa-miR-671-5p AGGAAGCCCUGGAGGGGCUGGAG
ENSBTAT00000046676 MI0005542 hsa-miR-876-3p UGGUGGUUUACAAAGUAAUUCA
ENSBTAT00000046676 MI0005560 hsa-miR-885-3p AGGCAGCGGGGUGUAGUGGAUA
ENSBTAT00000046676 MI0005762 hsa-miR-940 AAGGCAGGGCCCCCGCUCCCC
ENSBTAT00000046676 MI0004660 mmu-miR-692 AUCUCUUUGAGCGCCUCACUC
ENSBTAT00000046676 MI0004661 mmu-miR-692 AUCUCUUUGAGCGCCUCACUC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_584132  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene