ABCA6 | GeneID:537351 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 537351 Official Symbol ABCA6
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family A (ABC1), member 6
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 71264

ID Symbol Protein Species
GeneID:23460 ABCA6 NP_525023.2 Homo sapiens
GeneID:76184 Abca6 NP_671751.1 Mus musculus
GeneID:480456 ABCA6 XP_850922.1 Canis lupus familiaris
GeneID:537351 ABCA6 XP_617513.3 Bos taurus
GeneID:742817 ABCA6 XP_001146278.1 Pan troglodytes

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_617513 XP_617513

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000009089 MI0004752 bta-miR-125a UCCCUGAGACCCUUUAACCUGUG
ENSBTAT00000009089 MI0005035 bta-miR-192 CUGACCUAUGAAUUGACAGCCAG
ENSBTAT00000009089 MI0005016 bta-miR-215 AUGACCUAUGAAUUGACAGACA
ENSBTAT00000009089 MI0004733 bta-miR-29a CUAGCACCAUCUGAAAUCGGUUA
ENSBTAT00000009089 MI0005043 bta-miR-29b UAGCACCAUUUGAAAUCAGUGUUU
ENSBTAT00000009089 MI0005044 bta-miR-29c UAGCACCAUUUGAAAUCGGUUA
ENSBTAT00000009089 MI0004762 bta-miR-31 AGGCAAGAUGCUGGCAUAGCU
ENSBTAT00000009089 MI0000785 hsa-miR-377 AUCACACAAAGGCAACUUUUGU
ENSBTAT00000009089 MI0003685 hsa-miR-421 AUCAACAGACAUUAAUUGGGCGC
ENSBTAT00000009089 MI0003562 hsa-miR-556-5p GAUGAGCUCAUUGUAAUAUGAG
ENSBTAT00000009089 MI0003585 hsa-miR-578 CUUCUUGUGCUCUAGGAUUGU
ENSBTAT00000009089 MI0003588 hsa-miR-581 UCUUGUGUUCUCUAGAUCAGU
ENSBTAT00000009089 MI0003760 hsa-miR-671-3p UCCGGUUCUCAGGGCUCCACC
ENSBTAT00000009089 MI0005542 hsa-miR-876-5p UGGAUUUCUUUGUGAAUCACCA
ENSBTAT00000009089 MI0000097 hsa-miR-95 UUCAACGGGUAUUUAUUGAGCA
ENSBTAT00000009089 MI0002401 mmu-miR-466a-3p UAUACAUACACGCACACAUAAGA
ENSBTAT00000009089 MI0005504 mmu-miR-466b-3-3p AAUACAUACACGCACACAUAAGA
ENSBTAT00000009089 MI0005546 mmu-miR-466d-3p UAUACAUACACGCACACAUAG
ENSBTAT00000009089 MI0005203 mmu-miR-804 UGUGAGUUGUUCCUCACCUGGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_617513  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene