ABCG2 | GeneID:536203 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 536203 Official Symbol ABCG2
Locus N/A Gene Type protein-coding
Synonyms MGC127688
Full Name N/A
Description ATP-binding cassette, sub-family G (WHITE), member 2
Chromosome N/A
Also Known As ATP-binding cassette transporter subfamily G member 2; ATP-binding cassette, sub-family G, member 2; breast cancer resistance protein
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 55852

ID Symbol Protein Species
GeneID:9429 ABCG2 NP_004818.2 Homo sapiens
GeneID:26357 Abcg2 NP_036050.1 Mus musculus
GeneID:312382 Abcg2 NP_852046.1 Rattus norvegicus
GeneID:423767 ABCG2 XP_421638.2 Gallus gallus
GeneID:471251 ABCG2 XP_526633.2 Pan troglodytes
GeneID:478472 ABCG2 XP_535650.2 Canis lupus familiaris
GeneID:536203 ABCG2 NP_001032555.2 Bos taurus
GeneID:735310 abcg2d NP_001036237.1 Danio rerio
GeneID:811826 PF14_0244 XP_001348418.1 Plasmodium falciparum
GeneID:830541 AT5G06530 NP_850781.2 Arabidopsis thaliana
GeneID:850369 ADP1 NP_009937.2 Saccharomyces cerevisiae
GeneID:2679509 MGG_01563 XP_363637.2 Magnaporthe grisea
GeneID:2713604 NCU02544.1 XP_331743.1 Neurospora crassa
GeneID:2892892 KLLA0D04554g XP_453265.1 Kluyveromyces lactis
GeneID:4331674 Os03g0157400 NP_001049014.1 Oryza sativa
GeneID:4621257 AGOS_AER190W NP_985047.1 Eremothecium gossypii

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016020 Component membrane
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001037478 NP_001032555

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000023552 MI0005462 bta-miR-204 UUCCCUUUGUCAUCCUAUGCCU
ENSBTAT00000023552 MI0000287 hsa-miR-211 UUCCCUUUGUCAUCCUUCGCCU
ENSBTAT00000023552 MI0005569 hsa-miR-216b AAAUCUCUGCAGGCAAAUGUGA
ENSBTAT00000023552 MI0000791 hsa-miR-383 AGAUCAGAAGGUGAUUGUGGCU
ENSBTAT00000023552 MI0003590 hsa-miR-583 CAAAGAGGAAGGUCCCAUUAC
ENSBTAT00000023552 MI0000389 mmu-miR-291a-5p CAUCAAAGUGGAGGCCCUCUCU
ENSBTAT00000023552 MI0003539 mmu-miR-291b-5p GAUCAAAGUGGAGGCCCUCUCC
ENSBTAT00000023552 MI0004675 mmu-miR-695 AGAUUGGGCAUAGGUGACUGAA
ENSBTAT00000023552 MI0005477 mmu-miR-883b-5p UACUGAGAAUGGGUAGCAGUCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Olsen HG, et al. (2007) "Genetic support for a quantitative trait nucleotide in the ABCG2 gene affecting milk composition of dairy cattle." BMC Genet. 8():32. PMID:17584938
  2. [ + ] Ron M, et al. (2006) "Short communication: a polymorphism in ABCG2 in Bos indicus and Bos taurus cattle breeds." J Dairy Sci. 89(12):4921-4923. PMID:17106124
  3. [ + ] Tantia MS, et al. (2006) "DGAT1 and ABCG2 polymorphism in Indian cattle (Bos indicus) and buffalo (Bubalus bubalis) breeds." BMC Vet Res. 2():32. PMID:17087837
  4. [ + ] Harhay GP, et al. (2005) "Characterization of 954 bovine full-CDS cDNA sequences." BMC Genomics. 6():166. PMID:16305752
  5. [ + ] Cohen-Zinder M, et al. (2005) "Identification of a missense mutation in the bovine ABCG2 gene with a major effect on the QTL on chromosome 6 affecting milk yield and composition in Holstein cattle." Genome Res. 15(7):936-944. PMID:15998908
  6. [ + ] Sonstegard TS, et al. (2002) "Analysis of bovine mammary gland EST and functional annotation of the Bos taurus gene index." Mamm Genome. 13(7):373-379. PMID:12140684
  7. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932