ABCA1 | GeneID:535379 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 535379 Official Symbol ABCA1
Locus N/A Gene Type protein-coding
Synonyms ABC-1
Full Name N/A
Description ATP-binding cassette, sub-family A (ABC1), member 1
Chromosome N/A
Also Known As ATP-binding cassette sub-family A member 1; ATP-binding cassette transporter 1; ATP-binding cassette, sub-family A member 1; Cholesterol efflux regulatory protein
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 21130

ID Symbol Protein Species
GeneID:19 ABCA1 NP_005493.2 Homo sapiens
GeneID:11303 Abca1 NP_038482.3 Mus musculus
GeneID:313210 Abca1 NP_835196.1 Rattus norvegicus
GeneID:373945 ABCA1 NP_989476.1 Gallus gallus
GeneID:464630 ABCA1 XP_001138040.1 Pan troglodytes
GeneID:481651 ABCA1 XP_538773.2 Canis lupus familiaris
GeneID:535379 ABCA1 NP_001019864.1 Bos taurus
GeneID:558924 abca1a XP_687304.3 Danio rerio
GeneID:818768 AT2G41700 NP_850354.2 Arabidopsis thaliana

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005794 Component Golgi apparatus
GO:0005887 Component integral to plasma membrane
GO:0005886 Component plasma membrane
GO:0008509 Function anion transmembrane transporter activity
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0017127 Function cholesterol transporter activity
GO:0008237 Function metallopeptidase activity
GO:0000166 Function nucleotide binding
GO:0005548 Function phospholipid transporter activity
GO:0005515 Function protein binding
GO:0033344 Process cholesterol efflux
GO:0008203 Process cholesterol metabolic process
GO:0002790 Process peptide secretion
GO:0006911 Process phagocytosis, engulfment
GO:0033700 Process phospholipid efflux
GO:0045332 Process phospholipid translocation
GO:0006497 Process protein amino acid lipidation
GO:0006508 Process proteolysis
GO:0043691 Process reverse cholesterol transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001024693 NP_001019864

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000027538 MI0004734 bta-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENSBTAT00000027538 MI0005062 bta-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENSBTAT00000027538 MI0004757 bta-miR-181a AACAUUCAACGCUGUCGGUGAGUU
ENSBTAT00000027538 MI0005013 bta-miR-181b AACAUUCAUUGCUGUCGGUGGGUUU
ENSBTAT00000027538 MI0005061 bta-miR-532 CAUGCCUUGAGUGUAGGACCGU
ENSBTAT00000027538 MI0005025 bta-miR-98 UGAGGUAGUAAGUUGUAUUGUU
ENSBTAT00000027538 MI0004751 bta-miR-99a AACCCGUAGAUCCGAUCUUGU
ENSBTAT00000027538 MI0005469 bta-miR-99b CACCCGUAGAACCGACCUUGCG
ENSBTAT00000027538 MI0000102 hsa-miR-100 AACCCGUAGAUCCGAACUUGUG
ENSBTAT00000027538 MI0000460 hsa-miR-144 UACAGUAUAGAUGAUGUACU
ENSBTAT00000027538 MI0000272 hsa-miR-182 UUUGGCAAUGGUAGAACUCACACU
ENSBTAT00000027538 MI0000273 hsa-miR-183 UAUGGCACUGGUAGAAUUCACU
ENSBTAT00000027538 MI0000744 hsa-miR-299-5p UGGUUUACCGUCCCACAUACAU
ENSBTAT00000027538 MI0000091 hsa-miR-33a GUGCAUUGUAGUUGCAUUGCA
ENSBTAT00000027538 MI0003646 hsa-miR-33b GUGCAUUGCUGUUGCAUUGC
ENSBTAT00000027538 MI0003685 hsa-miR-421 AUCAACAGACAUUAAUUGGGCGC
ENSBTAT00000027538 MI0003132 hsa-miR-493 UGAAGGUCUACUGUGUGCCAGG
ENSBTAT00000027538 MI0003193 hsa-miR-506 UAAGGCACCCUUCUGAGUAGA
ENSBTAT00000027538 MI0003165 hsa-miR-517b UCGUGCAUCCCUUUAGAGUGUU
ENSBTAT00000027538 MI0003170 hsa-miR-518a-5p CUGCAAAGGGAAGCCCUUUC
ENSBTAT00000027538 MI0003173 hsa-miR-518a-5p CUGCAAAGGGAAGCCCUUUC
ENSBTAT00000027538 MI0003164 hsa-miR-520d-5p CUACAAAGGGAAGCCCUUUC
ENSBTAT00000027538 MI0003160 hsa-miR-524-3p GAAGGCGCUUCCCUUUGGAGU
ENSBTAT00000027538 MI0003160 hsa-miR-524-5p CUACAAAGGGAAGCACUUUCUC
ENSBTAT00000027538 MI0003152 hsa-miR-525-3p GAAGGCGCUUCCCUUUAGAGCG
ENSBTAT00000027538 MI0003596 hsa-miR-548b-5p AAAAGUAAUUGUGGUUUUGGCC
ENSBTAT00000027538 MI0003562 hsa-miR-556-3p AUAUUACCAUUAGCUCAUCUUU
ENSBTAT00000027538 MI0003581 hsa-miR-574-3p CACGCUCAUGCACACACCCACA
ENSBTAT00000027538 MI0003607 hsa-miR-595 GAAGUGUGCCGUGGUGUGUCU
ENSBTAT00000027538 MI0003642 hsa-miR-628-3p UCUAGUAAGAGUGGCAGUCGA
ENSBTAT00000027538 MI0003656 hsa-miR-641 AAAGACAUAGGAUAGAGUCACCUC
ENSBTAT00000027538 MI0003663 hsa-miR-648 AAGUGUGCAGGGCACUGGU
ENSBTAT00000027538 MI0000098 hsa-miR-96 UUUGGCACUAGCACAUUUUUGCU
ENSBTAT00000027538 MI0005511 mmu-miR-466h UGUGUGCAUGUGCUUGUGUGUA
ENSBTAT00000027538 MI0004666 mmu-miR-669b AGUUUUGUGUGCAUGUGCAUGU
ENSBTAT00000027538 MI0004662 mmu-miR-693-3p GCAGCUUUCAGAUGUGGCUGUAA
ENSBTAT00000027538 MI0004677 mmu-miR-696 GCGUGUGCUUGCUGUGGG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Farke C, et al. (2006) "Identification of the bovine cholesterol efflux regulatory protein ABCA1 and its expression in various tissues." J Anim Sci. 84(11):2887-2894. PMID:17032780