AADACL1 | GeneID:534212 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 534212 Official Symbol AADACL1
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description arylacetamide deacetylase-like 1
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 23251

ID Symbol Protein Species
GeneID:57552 AADACL1 NP_065843.3 Homo sapiens
GeneID:177791 esterase NP_501702.1 Caenorhabditis elegans
GeneID:181188 esterase NP_001024899.1 Caenorhabditis elegans
GeneID:189866 Y43F8A.3 NP_507771.2 Caenorhabditis elegans
GeneID:320024 Aadacl1 NP_848887.1 Mus musculus
GeneID:429158 AADACL1 XP_426713.2 Gallus gallus
GeneID:432374 zgc:92416 NP_001002303.1 Danio rerio
GeneID:470998 AADACL1 XP_526382.2 Pan troglodytes
GeneID:488171 AADACL1 XP_545295.2 Canis lupus familiaris
GeneID:534212 AADACL1 XP_584246.3 Bos taurus
GeneID:777713 zgc:153038 NP_001071229.1 Danio rerio
GeneID:797436 LOC797436 XP_001335382.1 Danio rerio

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005783 Component endoplasmic reticulum
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0005792 Component microsome
GO:0004091 Function carboxylesterase activity
GO:0042301 Function phosphate binding
GO:0017171 Function serine hydrolase activity
GO:0016042 Process lipid catabolic process
GO:0008152 Process metabolic process
GO:0006470 Process protein amino acid dephosphorylation
GO:0006805 Process xenobiotic metabolic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001123034 NP_001116506
2 XM_584246 XP_584246

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000026745 MI0002401 mmu-miR-466a-3p UAUACAUACACGCACACAUAAGA
ENSBTAT00000026745 MI0005504 mmu-miR-466b-3-3p AAUACAUACACGCACACAUAAGA
ENSBTAT00000026745 MI0005546 mmu-miR-466d-3p UAUACAUACACGCACACAUAG
ENSBTAT00000026745 MI0005507 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSBTAT00000026745 MI0005508 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSBTAT00000026745 MI0005509 mmu-miR-466f-3p CAUACACACACACAUACACAC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene