ABCC3 | GeneID:533151 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 533151 Official Symbol ABCC3
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family C (CFTR/MRP), member 3
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 68364

ID Symbol Protein Species
GeneID:8714 ABCC3 NP_003777.2 Homo sapiens
GeneID:76408 Abcc3 NP_083876.3 Mus musculus
GeneID:140668 Abcc3 NP_542148.1 Rattus norvegicus
GeneID:181202 mrp-4 NP_509658.1 Caenorhabditis elegans
GeneID:422099 ABCC3 XP_420102.2 Gallus gallus
GeneID:491084 ABCC3 XP_548204.2 Canis lupus familiaris
GeneID:533151 ABCC3 XP_612461.3 Bos taurus
GeneID:747938 ABCC3 XP_001158914.1 Pan troglodytes
GeneID:839921 ATMRP13 NP_174330.1 Arabidopsis thaliana
GeneID:839922 ATMRP12 NP_174331.2 Arabidopsis thaliana

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0005215 Function transporter activity
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_612461 XP_612461

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000026744 MI0005027 bta-miR-124a UUAAGGCACGCGGUGAAUGCCAA
ENSBTAT00000026744 MI0000475 hsa-miR-136 ACUCCAUUUGUUUUGAUGAUGGA
ENSBTAT00000026744 MI0000262 hsa-miR-147 GUGUGUGGAAAUGCUUCUGC
ENSBTAT00000026744 MI0000481 hsa-miR-184 UGGACGGAGAACUGAUAAGGGU
ENSBTAT00000026744 MI0000484 hsa-miR-188-5p CAUCCCUUGCAUGGUGGAGGG
ENSBTAT00000026744 MI0000283 hsa-miR-203 GUGAAAUGUUUAGGACCACUAG
ENSBTAT00000026744 MI0000738 hsa-miR-302a UAAGUGCUUCCAUGUUUUGGUGA
ENSBTAT00000026744 MI0000808 hsa-miR-326 CCUCUGGGCCCUUCCUCCAG
ENSBTAT00000026744 MI0000781 hsa-miR-373 GAAGUGCUUCGAUUUUGGGGUGU
ENSBTAT00000026744 MI0001145 hsa-miR-384 AUUCCUAGAAAUUGUUCAUA
ENSBTAT00000026744 MI0003131 hsa-miR-492 AGGACCUGCGGGACAAGAUUCUU
ENSBTAT00000026744 MI0003134 hsa-miR-494 UGAAACAUACACGGGAAACCUC
ENSBTAT00000026744 MI0003193 hsa-miR-506 UAAGGCACCCUUCUGAGUAGA
ENSBTAT00000026744 MI0003155 hsa-miR-520b AAAGUGCUUCCUUUUAGAGGG
ENSBTAT00000026744 MI0003158 hsa-miR-520c-3p AAAGUGCUUCCUUUUAGAGGGU
ENSBTAT00000026744 MI0003164 hsa-miR-520d-3p AAAGUGCUUCUCUUUGGUGGGU
ENSBTAT00000026744 MI0003143 hsa-miR-520e AAAGUGCUUCCUUUUUGAGGG
ENSBTAT00000026744 MI0003146 hsa-miR-520f AAGUGCUUCCUUUUAGAGGGUU
ENSBTAT00000026744 MI0003596 hsa-miR-548b-3p CAAGAACCUCAGUUGCUUUUGU
ENSBTAT00000026744 MI0003596 hsa-miR-548b-5p AAAAGUAAUUGUGGUUUUGGCC
ENSBTAT00000026744 MI0003630 hsa-miR-548c-3p CAAAAAUCUCAAUUACUUUUGC
ENSBTAT00000026744 MI0003668 hsa-miR-548d-3p CAAAAACCACAGUUUCUUUUGC
ENSBTAT00000026744 MI0003671 hsa-miR-548d-3p CAAAAACCACAGUUUCUUUUGC
ENSBTAT00000026744 MI0003637 hsa-miR-623 AUCCCUUGCAGGGGCUGUUGGGU
ENSBTAT00000026744 MI0003645 hsa-miR-631 AGACCUGGCCCAGACCUCAGC
ENSBTAT00000026744 MI0003761 hsa-miR-668 UGUCACUCGGCUCGGCCCACUAC
ENSBTAT00000026744 MI0002399 mmu-miR-464 UACCAAGUUUAUUCUGUGAGAUA
ENSBTAT00000026744 MI0004652 mmu-miR-687 CUAUCCUGGAAUGCAGCAAUGA
ENSBTAT00000026744 MI0004695 mmu-miR-711 GGGACCCGGGGAGAGAUGUAAG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_612461  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene