ABCB11 | GeneID:531150 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 531150 Official Symbol ABCB11
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family B (MDR/TAP), member 11
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 74509

ID Symbol Protein Species
GeneID:8647 ABCB11 NP_003733.2 Homo sapiens
GeneID:27413 Abcb11 NP_066302.2 Mus musculus
GeneID:470717 ABCB11 XP_526100.2 Pan troglodytes
GeneID:488390 ABCB11 XP_545512.2 Canis lupus familiaris
GeneID:531150 ABCB11 XP_609636.3 Bos taurus
GeneID:570936 LOC570936 XP_699562.3 Danio rerio
GeneID:571189 LOC571189 XP_001923538.1 Danio rerio
GeneID:4324720 Os01g0723800 NP_001044110.1 Oryza sativa

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_609636 XP_609636

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000046707 MI0005044 bta-miR-29c UAGCACCAUUUGAAAUCGGUUA
ENSBTAT00000046707 MI0000450 hsa-miR-133a UUUGGUCCCCUUCAACCAGCUG
ENSBTAT00000046707 MI0000451 hsa-miR-133a UUUGGUCCCCUUCAACCAGCUG
ENSBTAT00000046707 MI0000822 hsa-miR-133b UUUGGUCCCCUUCAACCAGCUA
ENSBTAT00000046707 MI0000086 hsa-miR-28-3p CACUAGAUUGUGAGCUCCUGGA
ENSBTAT00000046707 MI0003125 hsa-miR-490-5p CCAUGGAUCUCCAGGUGGGU
ENSBTAT00000046707 MI0003196 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENSBTAT00000046707 MI0005530 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENSBTAT00000046707 MI0005717 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENSBTAT00000046707 MI0005565 hsa-miR-543 AAACAUUCGCGGUGCACUUCUU
ENSBTAT00000046707 MI0003668 hsa-miR-548d-5p AAAAGUAAUUGUGGUUUUUGCC
ENSBTAT00000046707 MI0003671 hsa-miR-548d-5p AAAAGUAAUUGUGGUUUUUGCC
ENSBTAT00000046707 MI0005537 hsa-miR-888 UACUCAAAAAGCUGUCAGUCA
ENSBTAT00000046707 MI0003539 mmu-miR-291b-5p GAUCAAAGUGGAGGCCCUCUCC
ENSBTAT00000046707 MI0005510 mmu-miR-466g AUACAGACACAUGCACACACA
ENSBTAT00000046707 MI0004678 mmu-miR-720 AUCUCGCUGGGGCCUCCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_609636  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene