ABCF3 | GeneID:530975 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 530975 Official Symbol ABCF3
Locus N/A Gene Type protein-coding
Synonyms MGC137960
Full Name N/A
Description ATP-binding cassette, sub-family F (GCN20), member 3
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 22784

ID Symbol Protein Species
GeneID:27406 Abcf3 NP_038880.1 Mus musculus
GeneID:40131 CG9330 NP_649129.1 Drosophila melanogaster
GeneID:55324 ABCF3 NP_060828.2 Homo sapiens
GeneID:175873 abcf-3 NP_498339.1 Caenorhabditis elegans
GeneID:287982 Abcf3 NP_001011896.1 Rattus norvegicus
GeneID:424950 ABCF3 XP_422757.2 Gallus gallus
GeneID:460884 ABCF3 XP_516910.2 Pan troglodytes
GeneID:478651 ABCF3 XP_859024.1 Canis lupus familiaris
GeneID:530975 ABCF3 XP_001252189.1 Bos taurus
GeneID:842763 ATGCN3 NP_176636.1 Arabidopsis thaliana
GeneID:850561 GCN20 NP_116664.1 Saccharomyces cerevisiae
GeneID:1267735 ENSANGG00000000043 XP_306294.2 Anopheles gambiae
GeneID:1280669 AgaP_AGAP012005 XP_320530.2 Anopheles gambiae
GeneID:2540597 SPBC29A3.09c NP_595837.1 Schizosaccharomyces pombe
GeneID:2705213 NCU04051.1 XP_323370.1 Neurospora crassa
GeneID:2896717 KLLA0A10857g XP_451473.1 Kluyveromyces lactis
GeneID:4331217 Os02g0826500 NP_001048587.1 Oryza sativa
GeneID:4621026 AGOS_AEL032W NP_984829.1 Eremothecium gossypii
GeneID:5050704 MGG_11547 XP_001411010.1 Magnaporthe grisea
GeneID:100149614 LOC100149614 XP_001922895.1 Danio rerio

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001083457 NP_001076926

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000009087 MI0004735 bta-miR-101 UACAGUACUGUGAUAACUGAA
ENSBTAT00000009087 MI0005028 bta-miR-132 UAACAGUCUACAGCCAUGGUCG
ENSBTAT00000009087 MI0005031 bta-miR-17-3p ACUGCAGUGAAGGCACUUGU
ENSBTAT00000009087 MI0005069 bta-miR-363 AUUGCACGGUAUCCAUCUGCG
ENSBTAT00000009087 MI0000450 hsa-miR-133a UUUGGUCCCCUUCAACCAGCUG
ENSBTAT00000009087 MI0000451 hsa-miR-133a UUUGGUCCCCUUCAACCAGCUG
ENSBTAT00000009087 MI0000822 hsa-miR-133b UUUGGUCCCCUUCAACCAGCUA
ENSBTAT00000009087 MI0005544 hsa-miR-147b GUGUGCGGAAAUGCUUCUGCUA
ENSBTAT00000009087 MI0000288 hsa-miR-212 UAACAGUCUCCAGUCACGGCC
ENSBTAT00000009087 MI0000747 hsa-miR-296-3p GAGGGUUGGGUGGAGGCUCUCC
ENSBTAT00000009087 MI0000775 hsa-miR-367 AAUUGCACUUUAGCAAUGGUGA
ENSBTAT00000009087 MI0002467 hsa-miR-483-3p UCACUCCUCUCCUCCCGUCUU
ENSBTAT00000009087 MI0002470 hsa-miR-486-5p UCCUGUACUGAGCUGCCCCGAG
ENSBTAT00000009087 MI0003188 hsa-miR-503 UAGCAGCGGGAACAGUUCUGCAG
ENSBTAT00000009087 MI0005717 hsa-miR-509-3-5p UACUGCAGACGUGGCAAUCAUG
ENSBTAT00000009087 MI0003196 hsa-miR-509-5p UACUGCAGACAGUGGCAAUCA
ENSBTAT00000009087 MI0005530 hsa-miR-509-5p UACUGCAGACAGUGGCAAUCA
ENSBTAT00000009087 MI0003570 hsa-miR-564 AGGCACGGUGUCAGCAGGC
ENSBTAT00000009087 MI0003597 hsa-miR-588 UUGGCCACAAUGGGUUAGAAC
ENSBTAT00000009087 MI0003603 hsa-miR-591 AGACCAUGGGUUCUCAUUGU
ENSBTAT00000009087 MI0003625 hsa-miR-612 GCUGGGCAGGGCUUCUGAGCUCCUU
ENSBTAT00000009087 MI0003637 hsa-miR-623 AUCCCUUGCAGGGGCUGUUGGGU
ENSBTAT00000009087 MI0003645 hsa-miR-631 AGACCUGGCCCAGACCUCAGC
ENSBTAT00000009087 MI0003760 hsa-miR-671-3p UCCGGUUCUCAGGGCUCCACC
ENSBTAT00000009087 MI0005560 hsa-miR-885-3p AGGCAGCGGGGUGUAGUGGAUA
ENSBTAT00000009087 MI0002637 mml-miR-189 GUGCCUACUGAGCUGAUAUCAGU
ENSBTAT00000009087 MI0000625 mmu-miR-341 UCGGUCGAUCGGUCGGUCGGU
ENSBTAT00000009087 MI0003517 mmu-miR-546 AUGGUGGCACGGAGUC
ENSBTAT00000009087 MI0004553 mmu-miR-666-5p AGCGGGCACAGCUGUGAGAGCC
ENSBTAT00000009087 MI0004523 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENSBTAT00000009087 MI0004667 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENSBTAT00000009087 MI0004668 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENSBTAT00000009087 MI0004643 mmu-miR-681 CAGCCUCGCUGGCAGGCAGCU
ENSBTAT00000009087 MI0004696 mmu-miR-712 CUCCUUCACCCGGGCGGUACC
ENSBTAT00000009087 MI0004306 mmu-miR-761 GCAGCAGGGUGAAACUGACACA
ENSBTAT00000009087 MI0000636 rno-miR-349 CAGCCCUGCUGUCUUAACCUCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene