AADACL3 | GeneID:530613 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 530613 Official Symbol AADACL3
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description arylacetamide deacetylase-like 3
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 28426

ID Symbol Protein Species
GeneID:126767 AADACL3 NP_001096640.1 Homo sapiens
GeneID:230883 Aadacl3 XP_144109.1 Mus musculus
GeneID:313686 Aadacl3 XP_233636.4 Rattus norvegicus
GeneID:457970 AADACL3 XP_514407.2 Pan troglodytes
GeneID:487435 AADACL3 XP_544560.2 Canis lupus familiaris
GeneID:530613 AADACL3 XP_609088.2 Bos taurus

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0004091 Function carboxylesterase activity
GO:0016787 Function hydrolase activity
GO:0008152 Process metabolic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_609088 XP_609088

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000020432 MI0005069 bta-miR-363 AUUGCACGGUAUCCAUCUGCG
ENSBTAT00000020432 MI0005024 bta-miR-92 UAUUGCACUUGUCCCGGCCUGU
ENSBTAT00000020432 MI0000240 hsa-miR-198 GGUCCAGAGGGGAGAUAGGUUC
ENSBTAT00000020432 MI0000086 hsa-miR-28-3p CACUAGAUUGUGAGCUCCUGGA
ENSBTAT00000020432 MI0000090 hsa-miR-32 UAUUGCACAUUACUAAGUUGCA
ENSBTAT00000020432 MI0000814 hsa-miR-338-3p UCCAGCAUCAGUGAUUUUGUUG
ENSBTAT00000020432 MI0002467 hsa-miR-483-3p UCACUCCUCUCCUCCCGUCUU
ENSBTAT00000020432 MI0003131 hsa-miR-492 AGGACCUGCGGGACAAGAUUCUU
ENSBTAT00000020432 MI0003177 hsa-miR-522 AAAAUGGUUCCCUUUAGAGUGU
ENSBTAT00000020432 MI0003594 hsa-miR-586 UAUGCAUUGUAUUUUUAGGUCC
ENSBTAT00000020432 MI0003602 hsa-miR-590-5p GAGCUUAUUCAUAAAAGUGCAG
ENSBTAT00000020432 MI0005118 hsa-miR-770-5p UCCAGUACCACGUGUCAGGGCCA
ENSBTAT00000020432 MI0005715 hsa-miR-923 GUCAGCGGAGGAAAAGAAACU
ENSBTAT00000020432 MI0000244 mmu-miR-201 UACUCAGUAAGGCAUUGUUCUU
ENSBTAT00000020432 MI0005494 mmu-miR-343 UCUCCCUUCAUGUGCCCAGA
ENSBTAT00000020432 MI0004696 mmu-miR-712 CUCCUUCACCCGGGCGGUACC
ENSBTAT00000020432 MI0004310 mmu-miR-764-3p AGGAGGCCAUAGUGGCAACUGU
ENSBTAT00000020432 MI0005476 mmu-miR-883a-3p UAACUGCAACAGCUCUCAGUAU
ENSBTAT00000020432 MI0005477 mmu-miR-883b-3p UAACUGCAACAUCUCUCAGUAU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_609088  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]