ABCB9 | GeneID:529923 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 529923 Official Symbol ABCB9
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family B (MDR/TAP), member 9
Chromosome N/A
Also Known As
Summary N/A

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_001790018 XP_001790070
2 XM_001790020 XP_001790072

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000011137 MI0005010 bta-miR-140 UACCACAGGGUAGAACCACGGA
ENSBTAT00000011137 MI0004756 bta-miR-145 GUCCAGUUUUCCCAGGAAUCCCU
ENSBTAT00000011137 MI0005058 bta-miR-150 UCUCCCAACCCUUGUACCAGUGU
ENSBTAT00000011137 MI0004761 bta-miR-30b UGUAAACAUCCUACACUCAGCU
ENSBTAT00000011137 MI0000478 hsa-miR-149 UCUGGCUCCGUGUCUUCACUCCC
ENSBTAT00000011137 MI0000238 hsa-miR-196a UAGGUAGUUUCAUGUUGUUGGG
ENSBTAT00000011137 MI0000279 hsa-miR-196a UAGGUAGUUUCAUGUUGUUGGG
ENSBTAT00000011137 MI0001150 hsa-miR-196b UAGGUAGUUUCCUGUUGUUGGG
ENSBTAT00000011137 MI0000296 hsa-miR-219-1-3p AGAGUUGAGUCUGGACGUCCCG
ENSBTAT00000011137 MI0005529 hsa-miR-220b CCACCACCGUGUCUGACACUU
ENSBTAT00000011137 MI0005536 hsa-miR-220c ACACAGGGCUGUUGUGAAGACU
ENSBTAT00000011137 MI0000813 hsa-miR-324-5p CGCAUCCCCUAGGGCAUUGGUGU
ENSBTAT00000011137 MI0000804 hsa-miR-328 CUGGCCCUCUCUGCCCUUCCGU
ENSBTAT00000011137 MI0003131 hsa-miR-492 AGGACCUGCGGGACAAGAUUCUU
ENSBTAT00000011137 MI0003610 hsa-miR-598 UACGUCAUCGUUGUCAUCGUCA
ENSBTAT00000011137 MI0003621 hsa-miR-608 AGGGGUGGUGUUGGGACAGCUCCGU
ENSBTAT00000011137 MI0003645 hsa-miR-631 AGACCUGGCCCAGACCUCAGC
ENSBTAT00000011137 MI0003672 hsa-miR-663 AGGCGGGGCGCCGCGGGACCGC
ENSBTAT00000011137 MI0005563 hsa-miR-665 ACCAGGAGGCUGAGGCCCCU
ENSBTAT00000011137 MI0005560 hsa-miR-885-3p AGGCAGCGGGGUGUAGUGGAUA
ENSBTAT00000011137 MI0004635 mmu-miR-678 GUCUCGGUGCAAGGACUGGAGG
ENSBTAT00000011137 MI0004683 mmu-miR-699 AGGCAGUGCGACCUGGCUCG
ENSBTAT00000011137 MI0004695 mmu-miR-711 GGGACCCGGGGAGAGAUGUAAG
ENSBTAT00000011137 MI0004707 mmu-miR-718 CUUCCGCCCGGCCGGGUGUCG
ENSBTAT00000011137 MI0000635 rno-miR-347 UGUCCCUCUGGGUCGCCCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]