PIK3R1 | GeneID:5295 | Homo sapiens
Gene Summary
[
] NCBI Entrez Gene
| Gene ID | 5295 | Official Symbol | PIK3R1 |
|---|---|---|---|
| Locus | N/A | Gene Type | protein-coding |
| Synonyms | GRB1; p85; p85-ALPHA | ||
| Full Name | phosphoinositide-3-kinase, regulatory subunit 1 (alpha) | ||
| Description | phosphoinositide-3-kinase, regulatory subunit 1 (alpha) | ||
| Chromosome | 5q13.1 | ||
| Also Known As | phosphatidylinositol 3-kinase, regulatory subunit, polypeptide 1 (p85 alpha); phosphatidylinositol 3-kinase, regulatory, 1; phosphatidylinositol 3-kinase-associated p-85 alpha; phosphoinositide-3-kinase, regulatory subunit 1 (p85 alpha); phosphoinositide-3-kinase, regulatory subunit, polypeptide 1 (p85 alpha) | ||
| Summary | Phosphatidylinositol 3-kinase phosphorylates the inositol ring of phosphatidylinositol at the 3-prime position. The enzyme comprises a 110 kD catalytic subunit and a regulatory subunit of either 85, 55, or 50 kD. This gene encodes the 85 kD regulatory subunit. Phosphatidylinositol 3-kinase plays an important role in the metabolic actions of insulin, and a mutation in this gene has been associated with insulin resistance. Alternative splicing of this gene results in three transcript variants encoding different isoforms. [provided by RefSeq] | ||
Orthologs and Paralogs
[
] Homologs - NCBI's HomoloGene Group: 7889
| ID | Symbol | Protein | Species |
|---|---|---|---|
| GeneID:5295 | PIK3R1 | NP_852664.1 | Homo sapiens |
| GeneID:18708 | Pik3r1 | NP_001070963.1 | Mus musculus |
| GeneID:25513 | Pik3r1 | NP_037137.1 | Rattus norvegicus |
| GeneID:172141 | aap-1 | NP_491522.1 | Caenorhabditis elegans |
| GeneID:282307 | PIK3R1 | NP_777000.1 | Bos taurus |
| GeneID:427171 | PIK3R1 | XP_424759.1 | Gallus gallus |
| GeneID:461836 | PIK3R1 | XP_517729.2 | Pan troglodytes |
| GeneID:487235 | PIK3R1 | XP_850341.1 | Canis lupus familiaris |
| GeneID:557176 | LOC557176 | XP_683819.2 | Danio rerio |
Antibodies
[
] Monoclonal and Polyclonal Antibodies
| No. | Provider | Product No. | Description |
|---|---|---|---|
| 1 | abcam | ab63040 | PI 3 Kinase p85 alpha antibody (ab63040); Rabbit polyclonal to PI 3 Kinase p85 alpha |
| 2 | abcam | ab22653 | PI 3 Kinase p85 alpha antibody [Ab6] (ab22653); Mouse monoclonal [Ab6] to PI 3 Kinase p85 alpha |
| 3 | abcam | ab250 | PI 3 Kinase p85 alpha antibody [U13] (ab250); Mouse monoclonal [U13] to PI 3 Kinase p85 alpha |
| 4 | abcam | ab74136 | PI 3 Kinase p85 alpha + Gamma antibody (ab74136); Rabbit polyclonal to PI 3 Kinase p85 alpha + Gamma |
| 5 | abcam | ab71522 | PI 3 Kinase p85 alpha (phospho Y580) antibody (ab71522); Rabbit polyclonal to PI 3 Kinase p85 alpha (phospho Y580) |
| 6 | abcam | ab65261 | PI 3 Kinase p85 alpha (phospho Y368) antibody (ab65261); Rabbit polyclonal to PI 3 Kinase p85 alpha (phospho Y368) |
| 7 | abcam | ab63566 | PI 3 Kinase p85 (SH2) (phospho Y467 + Y199) antibody (ab63566); Rabbit polyclonal to PI 3 Kinase p85 (SH2) (phospho Y467 + Y199) |
| 8 | abcam | ab61801 | PI 3 Kinase p85 alpha (phospho Y607) antibody (ab61801); Rabbit polyclonal to PI 3 Kinase p85 alpha (phospho Y607) |
| 9 | abcam | ab40755 | PI 3 Kinase p85 alpha antibody [ep380y] (ab40755); Rabbit monoclonal [ep380y] to PI 3 Kinase p85 alpha |
| 10 | abcam | ab33093 | PI 3 Kinase p85 (SH2) antibody [0.T.112] (ab33093); Mouse monoclonal [0.T.112] to PI 3 Kinase p85 (SH2) |
| 11 | abcam | ab31688 | PI 3 Kinase p85 (SH2) antibody (ab31688); Rabbit polyclonal to PI 3 Kinase p85 (SH2) |
| 12 | abgent | AP8023e | PIK3R1 Antibody (Y556); Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab) |
| 13 | abgent | AP8023f | PIK3R1 Antibody (Y580); Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab) |
| 14 | abgent | AP8023g | PIK3R1 Antibody (Y368); Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab) |
| 15 | abgent | AP8023c | PIK3R1 Antibody (Y528); Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab) |
| 16 | abgent | AP8023d | PI3KR1 Antibody (N-term L11); Purified Rabbit Polyclonal Antibody (Pab) |
| 17 | abgent | AP3580a | Phospho-PIK3R1-pY528 Antibody; Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab) |
| 18 | abgent | AP3465a | Phospho-PIK3R1-Y556 Antibody; Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab) |
| 19 | abgent | AP8023a | PI3KR1 Antibody (N-term); Purified Rabbit Polyclonal Antibody (Pab) |
| 20 | abgent | AP3336a | Phospho-PIK3R1-Y368 Antibody; Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab) |
| 21 | abnova | H00005295-M01 | PIK3R1 monoclonal antibody (M01), clone 3A10; Mouse monoclonal antibody raised against a full length recombinant PIK3R1. |
| 22 | abnova | H00005295-M02 | PIK3R1 monoclonal antibody (M02), clone 1C10; Mouse monoclonal antibody raised against a full-length recombinant PIK3R1. |
| 23 | abnova | H00005295-M03 | PIK3R1 monoclonal antibody (M03), clone 3C11; Mouse monoclonal antibody raised against a full-length recombinant PIK3R1. |
| 24 | acris | SM1431P | PI-3 Kinase p85 alpha; antibody Ab |
| 25 | acris | AP14939PU-N | PI3KR1 (N-term); antibody Ab |
| 26 | acris | AP15730PU-N | PI3Kp85; antibody Ab |
| 27 | acris | SM1432 | PI-3 Kinase p85 alpha; antibody Ab |
| 28 | acris | AP12787PU-N | PIK3R1 pTyr368; antibody Ab |
| 29 | acris | AP12990PU-N | PIK3R1 pTyr528; antibody Ab |
| 30 | acris | AP14938PU-N | PIK3R1 Y528; antibody Ab |
| 31 | acris | AP15730PU-S | PI3Kp85; antibody Ab |
| 32 | acris | AP14940PU-N | PIK3R1 Y556; antibody Ab |
| 33 | acris | SM1431 | PI-3 Kinase p85 alpha; antibody Ab |
| 34 | acris | AP00566PU-N | PI-3 Kinase p85 alpha; antibody Ab |
| 35 | acris | AP14941PU-N | PIK3R1 Y580; antibody Ab |
| 36 | acris | AP14942PU-N | PIK3R1 Y368; antibody Ab |
| 37 | acris | AP14937PU-N | PI3KR1 (N-term); antibody Ab |
| 38 | acris | AP08765PU-S | PI3KP85 pTyr467; antibody Ab |
| 39 | acris | AP08765PU-N | PI3KP85 pTyr467; antibody Ab |
| 40 | acris | AP12881PU-N | PIK3R1 pTyr556; antibody Ab |
| 41 | scbt | PIK3R1 | PIK3R1 Antibody / PIK3R1 Antibodies; |
| 42 | sigma | HPA001216 | Anti-PIK3R1 antibody produced in rabbit ; |
Gene Classification
[
] Gene Ontology
| ID | Category | GO Term |
|---|---|---|
| GO:0005943 | Component | 1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex |
| GO:0005737 | Component | cytoplasm |
| GO:0005829 | Component | cytosol |
| GO:0005622 | Component | intracellular |
| GO:0016020 | Component | membrane |
| GO:0043125 | Function | ErbB-3 class receptor binding |
| GO:0043559 | Function | insulin binding |
| GO:0005159 | Function | insulin-like growth factor receptor binding |
| GO:0005158 | Function | insulin receptor binding |
| GO:0043560 | Function | insulin receptor substrate binding |
| GO:0005545 | Function | phosphatidylinositol binding |
| GO:0035014 | Function | phosphoinositide 3-kinase regulator activity |
| GO:0019903 | Function | protein phosphatase binding |
| GO:0030183 | Process | B cell differentiation |
| GO:0060396 | Process | growth hormone receptor signaling pathway |
| GO:0048009 | Process | insulin-like growth factor receptor signaling pathway |
| GO:0008286 | Process | insulin receptor signaling pathway |
| GO:0044419 | Process | interspecies interaction between organisms |
| GO:0043066 | Process | negative regulation of apoptosis |
| GO:0001953 | Process | negative regulation of cell-matrix adhesion |
| GO:0045671 | Process | negative regulation of osteoclast differentiation |
| GO:0014065 | Process | phosphoinositide 3-kinase cascade |
| GO:0046854 | Process | phosphoinositide phosphorylation |
| GO:0030335 | Process | positive regulation of cell migration |
| GO:0046326 | Process | positive regulation of glucose import |
| GO:0006468 | Process | protein amino acid phosphorylation |
| GO:0070201 | Process | regulation of establishment of protein localization |
| GO:0007165 | Process | signal transduction |
MicroRNA and Targets
[
] MicroRNA Sequences and Transcript Targets from miRBase at Sanger
| RNA Target | miRNA # | mat miRNA | Mature miRNA Sequence |
|---|---|---|---|
| ENST00000274335 | MI0000475 | hsa-miR-136 | ACUCCAUUUGUUUUGAUGAUGGA |
| ENST00000274335 | MI0000261 | hsa-miR-139-5p | UCUACAGUGCACGUGUCUCCAG |
| ENST00000274335 | MI0000115 | hsa-miR-16-2* | CCAAUAUUACUGUGCUGCUUUA |
| ENST00000274335 | MI0005529 | hsa-miR-220b | CCACCACCGUGUCUGACACUU |
| ENST00000274335 | MI0003513 | hsa-miR-455-5p | UAUGUGCCUUUGGACUACAUCG |
| ENST00000274335 | MI0003135 | hsa-miR-495 | AAACAAACAUGGUGCACUUCUU |
| ENST00000274335 | MI0003136 | hsa-miR-496 | UGAGUAUUACAUGGCCAAUCUC |
| ENST00000274335 | MI0003579 | hsa-miR-572 | GUCCGCUCGGCGGUGGCCCA |
| ENST00000274335 | MI0003586 | hsa-miR-579 | UUCAUUUGGUAUAAACCGCGAUU |
| ENST00000274335 | MI0003602 | hsa-miR-590-5p | GAGCUUAUUCAUAAAAGUGCAG |
| ENST00000274335 | MI0003644 | hsa-miR-630 | AGUAUUCUGUACCAGGGAAGGU |
| ENST00000274335 | MI0003763 | hsa-miR-767-5p | UGCACCAUGGUUGUCUGAGCAUG |
| ENST00000274335 | MI0000389 | mmu-miR-291a-5p | CAUCAAAGUGGAGGCCCUCUCU |
| ENST00000274335 | MI0003539 | mmu-miR-291b-3p | AAAGUGCAUCCAUUUUGUUUGU |
| ENST00000274335 | MI0003539 | mmu-miR-291b-5p | GAUCAAAGUGGAGGCCCUCUCC |
| ENST00000320694 | MI0003513 | hsa-miR-455-3p | GCAGUCCAUGGGCAUAUACAC |
Chemicals and Drugs
[
] Comparative Toxicogenomics Database from MDI Biological Lab
Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
| Chemical and Interaction | |
|---|---|
| Adenosine Triphosphate | |
|
|
| alitretinoin | |
|
|
| BMS 649 | |
|
|
| BMS 961 | |
|
|
| Deferoxamine | |
|
|
| ferrous sulfate | |
|
|
| Folic Acid | |
|
|
| garcinol | |
|
|
| gedunin | |
|
|
| Iron | |
|
|
| octa-2,4,6-trienoic acid | |
|
|
| oxophenylarsine | |
|
|
| Paraquat | |
|
|
| Phenobarbital | |
|
|
| resveratrol | |
|
|
| resveratrol | |
|
|
| resveratrol | |
|
|
| retinol acetate | |
|
|
| Ro 65-7199 | |
|
|
| Ro 66-0074 | |
|
|
| S-Nitrosoglutathione | |
|
|
| tert-Butylhydroperoxide | |
|
|
| Tretinoin | |
|
|
| tripterine | |
|
|
| Tunicamycin | |
|
|
| Uranium | |
|
|
| uranyl acetate | |
|
|
Gene and Diseases
[
] Gene and Diseases [Data source: CTD]
Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Gene Interactions
[
] BioGRID Gene Product Interaction Database
| Symbol | Interaction Binary | Experiment | Source |
|---|---|---|---|
| ABL1 | ABL1 / PIK3R1 | Reconstituted Complex | Kapeller R (1994) |
| ADAM12 | ADAM12 / PIK3R1 | Affinity Capture-Western | Kang Q (2001) |
| ADAM12 | PIK3R1 / ADAM12 | Affinity Capture-Western | Kang Q (2001) |
| ADAM12 | PIK3R1 / ADAM12 | Reconstituted Complex | Kang Q (2001) |
| ARAF | ARAF / PIK3R1 | Reconstituted Complex | Fang Y (2002) |
| ARHGAP1 | PIK3R1 / ARHGAP1 | Reconstituted Complex | Barfod ET (1993) |
| ARHGAP17 | ARHGAP17 / PIK3R1 | Reconstituted Complex | Richnau N (2001) |
| AXL | AXL / PIK3R1 | Biochemical Activity | Braunger J (1997) |
| BCAR1 | BCAR1 / PIK3R1 | Affinity Capture-Western | Li E (2000) |
| BCAR1 | PIK3R1 / BCAR1 | Reconstituted Complex | Li E (2000) |
| CBL | CBL / PIK3R1 | Affinity Capture-Western | Gesbert F (1998) |
| CBL | PIK3R1 / CBL | Affinity Capture-Western | Gesbert F (1998) |
| CBL | CBL / PIK3R1 | Affinity Capture-Western | Zhang S (1999) |
| CBLB | CBLB / PIK3R1 | Affinity Capture-Western | Lavagna-Sevenier C (1998) |
| CD28 | CD28 / PIK3R1 | Affinity Capture-Western | Pages F (1996) |
| CD28 | PIK3R1 / CD28 | Protein-peptide | Pages F (1996) |
| CD3E | CD3E / PIK3R1 | Affinity Capture-Western | de Aos I (1997) |
| CD5 | PIK3R1 / CD5 | Invivo | Dennehy KM (1997) |
| CD7 | CD7 / PIK3R1 | Affinity Capture-Western | Subrahmanyam G (2003) |
| CD7 | PIK3R1 / CD7 | Reconstituted Complex | Lee DM (1996) |
| CDC42 | PIK3R1 / CDC42 | Invitro | Carpenter CL (1997) |
| CDC42 | PIK3R1 / CDC42 | Invivo | Carpenter CL (1997) |
| CENTG1 | PIK3R1 / CENTG1 | Affinity Capture-Western | Ye K (2000) |
| CENTG1 | CENTG1 / PIK3R1 | Reconstituted Complex | Ye K (2000) |
| CRKL | CRKL / PIK3R1 | Affinity Capture-Western | Gesbert F (1998) |
| CSF1R | PIK3R1 / CSF1R | Affinity Capture-Western | Kanagasundaram V (1996) |
| CSF2RA | CSF2RA / PIK3R1 | Affinity Capture-Western | Dhar-Mascareno M (2003) |
| Ctnnb1 | PIK3R1 / Ctnnb1 | Affinity Capture-Western | Espada J (1999) |
| CTNNB1 | CTNNB1 / PIK3R1 | Reconstituted Complex | Espada J (1999) |
| DOK1 | DOK1 / PIK3R1 | Reconstituted Complex | van Dijk TB (2000) |
| EPHA2 | PIK3R1 / EPHA2 | Affinity Capture-Western | Pandey A (1994) |
| EPHA2 | PIK3R1 / EPHA2 | Reconstituted Complex | Pandey A (1994) |
| EPHA2 | PIK3R1 / EPHA2 | Two-hybrid | Pandey A (1994) |
| EPOR | EPOR / PIK3R1 | Affinity Capture-Western | Damen JE (1995) |
| EPOR | EPOR / PIK3R1 | Affinity Capture-Western | Shigematsu H (1997) |
| EPOR | PIK3R1 / EPOR | Affinity Capture-Western | Shigematsu H (1997) |
| EPOR | PIK3R1 / EPOR | Reconstituted Complex | Damen JE (1995) |
| ERBB3 | ERBB3 / PIK3R1 | Affinity Capture-Western | Hellyer NJ (2001) |
| ERBB3 | PIK3R1 / ERBB3 | Affinity Capture-Western | Lin J (1999) |
| ESR1 | ESR1 / PIK3R1 | Affinity Capture-Western | Castoria G (2001) |
| FCGR2A | FCGR2A / PIK3R1 | Affinity Capture-Western | Chacko GW (1996) |
| FCGR2A | FCGR2A / PIK3R1 | Reconstituted Complex | Ibarrola I (1997) |
| FES | PIK3R1 / FES | Affinity Capture-Western | Izuhara K (1996) |
| FYN | FYN / PIK3R1 | Reconstituted Complex | Kapeller R (1994) |
| GAB1 | GAB1 / PIK3R1 | Affinity Capture-Western | Holgado-Madruga M (1996) |
| GAB1 | GAB1 / PIK3R1 | Far Western | Holgado-Madruga M (1996) |
| GAB1 | PIK3R1 / GAB1 | Reconstituted Complex | Bertagnolo V (1998) |
| Gab2 | Gab2 / PIK3R1 | Affinity Capture-Western | Liu Y (2001) |
| Gab2 | PIK3R1 / Gab2 | Affinity Capture-Western | Liu Y (2001) |
| GAB2 | GAB2 / PIK3R1 | Affinity Capture-Western | Crouin C (2001) |
| GAB2 | GAB2 / PIK3R1 | Affinity Capture-Western | Lynch DK (2002) |
| GAB2 | GAB2 / PIK3R1 | Two-hybrid | Crouin C (2001) |
| GHR | PIK3R1 / GHR | Reconstituted Complex | Moutoussamy S (1998) |
| GNAQ | GNAQ / PIK3R1 | Affinity Capture-Western | Ballou LM (2003) |
| GRB2 | GRB2 / PIK3R1 | Affinity Capture-Western | Saleem A (1995) |
| GRB2 | GRB2 / PIK3R1 | Affinity Capture-Western | Wang J (1995) |
| GRB2 | GRB2 / PIK3R1 | Reconstituted Complex | Saleem A (1995) |
| GRB2 | GRB2 / PIK3R1 | Reconstituted Complex | Wang J (1995) |
| GRB2 | PIK3R1 / GRB2 | Two-hybrid | Wang J (1995) |
| HCST | PIK3R1 / HCST | Protein-peptide | Wu J (1999) |
| HRAS | PIK3R1 / HRAS | Affinity Capture-Western | Hanna AN (1999) |
| HRAS | PIK3R1 / HRAS | Reconstituted Complex | Rodriguez-Viciana P (1997) |
| IFNAR1 | IFNAR1 / PIK3R1 | Affinity Capture-Western | Rani MR (1999) |
| IGF1R | PIK3R1 / IGF1R | Invitro | Benito M (1996) |
| IL1R1 | IL1R1 / PIK3R1 | Affinity Capture-Western | Reddy SA (1997) |
| IL1R1 | PIK3R1 / IL1R1 | Affinity Capture-Western | Reddy SA (1997) |
| IL1R1 | IL1R1 / PIK3R1 | Invitro | Sizemore N (1999) |
| IL1RAP | IL1RAP / PIK3R1 | Invitro | Sizemore N (1999) |
| IL1RAP | IL1RAP / PIK3R1 | Invivo | Sizemore N (1999) |
| IL2RB | IL2RB / PIK3R1 | Invitro | Migone TS (1998) |
| IL2RB | IL2RB / PIK3R1 | Invivo | Migone TS (1998) |
| IL6ST | IL6ST / PIK3R1 | Affinity Capture-Western | Chung TD (2000) |
| INPP5D | PIK3R1 / INPP5D | Affinity Capture-Western | Zhang S (1999) |
| IRS1 | IRS1 / PIK3R1 | Affinity Capture-Western | Gual P (2003) |
| IRS1 | PIK3R1 / IRS1 | Affinity Capture-Western | Hadari YR (1992) |
| IRS1 | IRS1 / PIK3R1 | Affinity Capture-Western | Morrison KB (2002) |
| IRS1 | IRS1 / PIK3R1 | Far Western | Hamer I (2002) |
| IRS2 | IRS2 / PIK3R1 | Affinity Capture-Western | Argetsinger LS (1996) |
| IRS2 | IRS2 / PIK3R1 | Affinity Capture-Western | Kim B (1998) |
| IRS2 | IRS2 / PIK3R1 | Affinity Capture-Western | Verdier F (1997) |
| IRS2 | IRS2 / PIK3R1 | Far Western | Hamer I (2002) |
| JAK1 | JAK1 / PIK3R1 | Invivo | Migone TS (1998) |
| JAK2 | JAK2 / PIK3R1 | Affinity Capture-Western | Fuhrer DK (1996) |
| JAK2 | PIK3R1 / JAK2 | Affinity Capture-Western | Fuhrer DK (1996) |
| K-ALPHA-1 | PIK3R1 / K-ALPHA-1 | Affinity Capture-Western | Kapeller R (1995) |
| K-ALPHA-1 | PIK3R1 / K-ALPHA-1 | Reconstituted Complex | Kapeller R (1995) |
| KHDRBS1 | PIK3R1 / KHDRBS1 | Affinity Capture-Western | Sanchez-Margalet V (2001) |
| KHDRBS1 | KHDRBS1 / PIK3R1 | Affinity Capture-Western | Shen Z (1999) |
| KHDRBS1 | KHDRBS1 / PIK3R1 | Reconstituted Complex | Shen Z (1999) |
| KIT | KIT / PIK3R1 | Affinity Capture-Western | Serve H (1994) |
| KIT | KIT / PIK3R1 | Reconstituted Complex | van Dijk TB (2000) |
| KIT | KIT / PIK3R1 | Two-hybrid | De Sepulveda P (1999) |
| LAT | LAT / PIK3R1 | Affinity Capture-Western | Paz PE (2001) |
| LAT | LAT / PIK3R1 | Reconstituted Complex | Paz PE (2001) |
| LCK | LCK / PIK3R1 | Reconstituted Complex | Kapeller R (1994) |
| LCP2 | LCP2 / PIK3R1 | Affinity Capture-Western | Shim EK (2004) |
| LCP2 | LCP2 / PIK3R1 | Two-hybrid | Shim EK (2004) |
| NFKBIA | PIK3R1 / NFKBIA | Reconstituted Complex | Beraud C (1999) |
| NTRK2 | NTRK2 / PIK3R1 | Two-hybrid | Suzuki S (2002) |
| PDGFRB | PDGFRB / PIK3R1 | Invivo | Farooqui T () |
| PECAM1 | PECAM1 / PIK3R1 | Affinity Capture-Western | Pellegatta F (1998) |
| PIK3AP1 | PIK3R1 / PIK3AP1 | Affinity Capture-Western | Okada T (2000) |
| PIK3CA | PIK3R1 / PIK3CA | Reconstituted Complex | Woscholski R (1994) |
| PIK3CB | PIK3CB / PIK3R1 | Affinity Capture-Western | Hu P (1994) |
| PIK3CD | PIK3CD / PIK3R1 | Affinity Capture-Western | Vanhaesebroeck B (1997) |
| PIK3CD | PIK3CD / PIK3R1 | Reconstituted Complex | Vanhaesebroeck B (1997) |
| PIK3R1 | PIK3R1 / PIK3R1 | Reconstituted Complex | Kapeller R (1994) |
| PTK2 | PTK2 / PIK3R1 | Affinity Capture-Western | Guinebault C (1995) |
| PTK2 | PTK2 / PIK3R1 | Far Western | Guinebault C (1995) |
| PTPN11 | PIK3R1 / PTPN11 | Affinity Capture-Western | Zhang S (1999) |
| PTPN6 | PTPN6 / PIK3R1 | Two-hybrid | Sathish JG (2001) |
| PXN | PIK3R1 / PXN | Co-purification | Salgia R (1996) |
| RICS | RICS / PIK3R1 | Affinity Capture-Western | Moon SY (2003) |
| RRAS2 | PIK3R1 / RRAS2 | Affinity Capture-Western | Rong R (2002) |
| SH3KBP1 | PIK3R1 / SH3KBP1 | Reconstituted Complex | Gout I (2000) |
| SHB | SHB / PIK3R1 | Affinity Capture-Western | Karlsson T (1995) |
| SHB | SHB / PIK3R1 | Reconstituted Complex | Karlsson T (1995) |
| SHC1 | SHC1 / PIK3R1 | Reconstituted Complex | Harrison-Findik D (1995) |
| SRC | SRC / PIK3R1 | Affinity Capture-Western | Burnham MR (1999) |
| SYN1 | SYN1 / PIK3R1 | Invivo | Onofri F (2000) |
| TGFBR1 | TGFBR1 / PIK3R1 | Affinity Capture-Western | Krymskaya VP (1997) |
| TGFBR2 | TGFBR2 / PIK3R1 | Affinity Capture-Western | Krymskaya VP (1997) |
| Thra | Thra / PIK3R1 | Affinity Capture-Western | Kenessey A (2006) |
| TLN1 | PIK3R1 / TLN1 | Co-purification | Salgia R (1996) |
| TYRO3 | TYRO3 / PIK3R1 | Affinity Capture-Western | Lan Z (2000) |
| TYRO3 | TYRO3 / PIK3R1 | Two-hybrid | Lan Z (2000) |
| VAV1 | PIK3R1 / VAV1 | Affinity Capture-Western | Bertagnolo V (1998) |
| VAV1 | VAV1 / PIK3R1 | Affinity Capture-Western | Bertagnolo V (1998) |
| VAV1 | PIK3R1 / VAV1 | Affinity Capture-Western | Shigematsu H (1997) |
| VAV1 | VAV1 / PIK3R1 | Affinity Capture-Western | Shigematsu H (1997) |
| VAV1 | PIK3R1 / VAV1 | Reconstituted Complex | Bertagnolo V (1998) |
| VAV1 | PIK3R1 / VAV1 | Reconstituted Complex | Shigematsu H (1997) |
| VIL2 | PIK3R1 / VIL2 | Affinity Capture-Western | Gautreau A (1999) |
| VIL2 | VIL2 / PIK3R1 | Reconstituted Complex | Gautreau A (1999) |
| WAS | PIK3R1 / WAS | Affinity Capture-Western | Banin S (1996) |
| WAS | PIK3R1 / WAS | Reconstituted Complex | Banin S (1996) |
Selected Publications
[
] Gene-related publications indexed at PubMed
- [
] Ruano G, et al. (2009) "Physiogenomic comparison of edema and BMI in patients receiving rosiglitazone or pioglitazone." Clin Chim Acta. 400(1-2):48-55. PMID:18996102 - [
] Kim JJ, et al. (2009) "Phosphatidylinositol 3-kinase p85alpha regulatory subunit gene Met326Ile polymorphism in women with polycystic ovary syndrome." Hum Reprod. 24(5):1184-1190. PMID:19218574 - [
] Sulahian R, et al. (2009) "Ligand-induced EpoR internalization is mediated by JAK2 and p85 and is impaired by mutations responsible for primary familial and congenital polycythemia." Blood. 113(21):5287-5297. PMID:19336760 - [
] Blackford A, et al. (2009) "Genetic mutations associated with cigarette smoking in pancreatic cancer." Cancer Res. 69(8):3681-3688. PMID:19351817 - [
] Segovis CM, et al. (2009) "PI3K links NKG2D signaling to a CrkL pathway involved in natural killer cell adhesion, polarity, and granule secretion." J Immunol. 182(11):6933-6942. PMID:19454690 - [
] Wu TT, et al. (2008) "Reduction of PKC alpha decreases cell proliferation, migration, and invasion of human malignant hepatocellular carcinoma." J Cell Biochem. 103(1):9-20. PMID:17486587 - [
] Barbe L, et al. (2008) "Toward a confocal subcellular atlas of the human proteome." Mol Cell Proteomics. 7(3):499-508. PMID:18029348 - [
] Guiducci C, et al. (2008) "PI3K is critical for the nuclear translocation of IRF-7 and type I IFN production by human plasmacytoid predendritic cells in response to TLR activation." J Exp Med. 205(2):315-322. PMID:18227218 - [
] Li L, et al. (2008) "Association between phosphatidylinositol 3-kinase regulatory subunit p85alpha Met326Ile genetic polymorphism and colon cancer risk." Clin Cancer Res. 14(3):633-637. PMID:18245521 - [
] Jones MR, et al. (2008) "Polymorphism in postinsulin receptor signaling pathway is not associated with polycystic ovary syndrome." Fertil Steril. 90(6):2298-2303. PMID:18249389 - [
] Kleber S, et al. (2008) "Yes and PI3K bind CD95 to signal invasion of glioblastoma." Cancer Cell. 13(3):235-248. PMID:18328427 - [
] Desrivieres S, et al. (2008) "Nucleotide sequence variation within the PI3K p85 alpha gene associates with alcohol risk drinking behaviour in adolescents." PLoS ONE. 3(3):e1769. PMID:18335044 - [
] Zhu Q, et al. (2008) "Phosphoinositide 3-OH kinase p85alpha and p110beta are essential for androgen receptor transactivation and tumor progression in prostate cancers." Oncogene. 27(33):4569-4579. PMID:18372911 - [
] Dufour C, et al. (2008) "FGFR2-Cbl interaction in lipid rafts triggers attenuation of PI3K/Akt signaling and osteoblast survival." Bone. 42(6):1032-1039. PMID:18374639 - [
] Huang CH, et al. (2008) "Insights into the oncogenic effects of PIK3CA mutations from the structure of p110alpha/p85alpha." Cell Cycle. 7(9):1151-1156. PMID:18418043 - [
] Li Y, et al. (2008) "Mechanism of influenza A virus NS1 protein interaction with the p85beta, but not the p85alpha, subunit of phosphatidylinositol 3-kinase (PI3K) and up-regulation of PI3K activity." J Biol Chem. 283(34):23397-23409. PMID:18534979 - [
] Lu Y, et al. (2008) "Multiple genetic variants along candidate pathways influence plasma high-density lipoprotein cholesterol concentrations." J Lipid Res. 49(12):2582-2589. PMID:18660489 - [
] Torres VA, et al. (2008) "Caspase 8 promotes peripheral localization and activation of Rab5." J Biol Chem. 283(52):36280-36289. PMID:18974049 - [
] Boulay PL, et al. (2008) "ADP-ribosylation factor 1 controls the activation of the phosphatidylinositol 3-kinase pathway to regulate epidermal growth factor-dependent growth and migration of breast cancer cells." J Biol Chem. 283(52):36425-36434. PMID:18990689 - [
] Tokunaga E, et al. (2007) "Coexistence of the loss of heterozygosity at the PTEN locus and HER2 overexpression enhances the Akt activity thus leading to a negative progesterone receptor expression in breast carcinoma." Breast Cancer Res Treat. 101(3):249-257. PMID:17006756 - [
] Harir N, et al. (2007) "Constitutive activation of Stat5 promotes its cytoplasmic localization and association with PI3-kinase in myeloid leukemias." Blood. 109(4):1678-1686. PMID:17038539 - [
] Chugh P, et al. (2007) "Infection of human immunodeficiency virus and intracellular viral Tat protein exert a pro-survival effect in a human microglial cell line." J Mol Biol. 366(1):67-81. PMID:17157319 - [
] Jamshidi Y, et al. (2007) "SHP-2 and PI3-kinase genes PTPN11 and PIK3R1 may influence serum apoB and LDL cholesterol levels in normal women." Atherosclerosis. 194(2):e26-e33. PMID:17214991 - [
] Badour K, et al. (2007) "Interaction of the Wiskott-Aldrich syndrome protein with sorting nexin 9 is required for CD28 endocytosis and cosignaling in T cells." Proc Natl Acad Sci U S A. 104(5):1593-1598. PMID:17242350 - [
] Xie Z, et al. (2007) "The recruitment of phosphatidylinositol 3-kinase to the E-cadherin-catenin complex at the plasma membrane is required for calcium-induced phospholipase C-gamma1 activation and human keratinocyte differentiation." J Biol Chem. 282(12):8695-8703. PMID:17242406 - [
] Singh RS, et al. (2007) "Phosphoinositide 3-kinase is not overexpressed in melanocytic lesions." J Cutan Pathol. 34(3):220-225. PMID:17302605 - [
] Yu X, et al. (2007) "Regulation of scavenger receptor class BI gene expression by angiotensin II in vascular endothelial cells." Hypertension. 49(6):1378-1384. PMID:17404186 - [
] Kamen LA, et al. (2007) "Differential association of phosphatidylinositol 3-kinase, SHIP-1, and PTEN with forming phagosomes." Mol Biol Cell. 18(7):2463-2472. PMID:17442886 - [
] Yamaki N, et al. (2007) "RhoG regulates anoikis through a phosphatidylinositol 3-kinase-dependent mechanism." Exp Cell Res. 313(13):2821-2832. PMID:17570359 - [
] Hers I, et al. (2007) "Insulin-like growth factor-1 potentiates platelet activation via the IRS/PI3Kalpha pathway." Blood. 110(13):4243-4252. PMID:17827393 - [
] Nakhaei-Nejad M, et al. (2007) "Endothelial PI 3-kinase activity regulates lymphocyte diapedesis." Am J Physiol Heart Circ Physiol. 293(6):H3608-H3616. PMID:17890432 - [
] Huang CH, et al. (2007) "The structure of a human p110alpha/p85alpha complex elucidates the effects of oncogenic PI3Kalpha mutations." Science. 318(5857):1744-1748. PMID:18079394 - [
] Lottin-Divoux S, et al. (2006) "Activation of Epstein-Barr virus/C3d receptor (gp140, CR2, CD21) on human B lymphoma cell surface triggers Cbl tyrosine phosphorylation, its association with p85 subunit, Crk-L and Syk and its dissociation with Vav." Cell Signal. 18(8):1219-1225. PMID:16289966 - [
] Kwon M, et al. (2006) "Recruitment of the tyrosine phosphatase Src homology 2 domain tyrosine phosphatase-2 to the p85 subunit of phosphatidylinositol-3 (PI-3) kinase is required for insulin-like growth factor-I-dependent PI-3 kinase activation in smooth muscle cells." Endocrinology. 147(3):1458-1465. PMID:16306077 - [
] Ignatiuk A, et al. (2006) "The smaller isoforms of ankyrin 3 bind to the p85 subunit of phosphatidylinositol 3'-kinase and enhance platelet-derived growth factor receptor down-regulation." J Biol Chem. 281(9):5956-5964. PMID:16377635 - [
] Qiao J, et al. (2006) "Inhibition of transforming growth factor-beta/Smad signaling by phosphatidylinositol 3-kinase pathway." Cancer Lett. 242(2):207-214. PMID:16412560 - [
] Cornier MA, et al. (2006) "Nutritional upregulation of p85alpha expression is an early molecular manifestation of insulin resistance." Diabetologia. 49(4):748-754. PMID:16491394 - [
] Anand AR, et al. (2006) "HIV-1 gp120-mediated apoptosis of T cells is regulated by the membrane tyrosine phosphatase CD45." J Biol Chem. 281(18):12289-12299. PMID:16524887 - [
] Rhee SH, et al. (2006) "Role of MyD88 in phosphatidylinositol 3-kinase activation by flagellin/toll-like receptor 5 engagement in colonic epithelial cells." J Biol Chem. 281(27):18560-18568. PMID:16644730 - [
] Kenessey A, et al. (2006) "Thyroid hormone stimulates protein synthesis in the cardiomyocyte by activating the Akt-mTOR and p70S6K pathways." J Biol Chem. 281(30):20666-20672. PMID:16717100 - [
] Dance M, et al. (2006) "The adaptor protein Gab1 couples the stimulation of vascular endothelial growth factor receptor-2 to the activation of phosphoinositide 3-kinase." J Biol Chem. 281(32):23285-23295. PMID:16787925 - [
] Koga F, et al. (2006) "Hsp90 inhibition transiently activates Src kinase and promotes Src-dependent Akt and Erk activation." Proc Natl Acad Sci U S A. 103(30):11318-11322. PMID:16844778 - [
] Huang ZY, et al. (2006) "Differential kinase requirements in human and mouse Fc-gamma receptor phagocytosis and endocytosis." J Leukoc Biol. 80(6):1553-1562. PMID:16921024 - [
] Lee J, et al. (2006) "Autotaxin stimulates urokinase-type plasminogen activator expression through phosphoinositide 3-kinase-Akt-nuclear [corrected] factor kappa B signaling cascade in human melanoma cells." Melanoma Res. 16(5):445-452. PMID:17013094 - [
] Jamshidi Y, et al. (2006) "Phosphatidylinositol 3-kinase p85alpha regulatory subunit gene PIK3R1 haplotype is associated with body fat and serum leptin in a female twin population." Diabetologia. 49(11):2659-2667. PMID:17016694 - [
] Moon KD, et al. (2005) "Molecular basis for a direct interaction between the Syk protein-tyrosine kinase and phosphoinositide 3-kinase." J Biol Chem. 280(2):1543-1551. PMID:15536084 - [
] Klammt J, et al. (2005) "Comparative analysis of the signaling capabilities of the insulin receptor-related receptor." Biochem Biophys Res Commun. 327(2):557-564. PMID:15629149 - [
] Joseph AM, et al. (2005) "Nef: "necessary and enforcing factor" in HIV infection." Curr HIV Res. 3(1):87-94. PMID:15638726 - [
] Langford D, et al. (2005) "Signalling crosstalk in FGF2-mediated protection of endothelial cells from HIV-gp120." BMC Neurosci. 6():8. PMID:15689238 - [
] Koch A, et al. (2005) "The SH2-domian-containing inositol 5-phosphatase (SHIP)-2 binds to c-Met directly via tyrosine residue 1356 and involves hepatocyte growth factor (HGF)-induced lamellipodium formation, cell scattering and cell spreading." Oncogene. 24(21):3436-3447. PMID:15735664
BACKGROUND: The thiazolidinediones (TZDs) improve tissue sensitivity to insulin in patients with type II diabetes, resulting in reduced levels of fasting blood glucose and glycated hemoglobin. However, TZDs unpredictably demonstrate adverse effects of increased body weight, fluid retention, and edema. The balance of efficacy and safety of TZD varies widely from patient to patient. Genetic variability may reveal pathophysiological pathways underlying weight gain associated with TZD therapy and due to adiposity and/or edema. METHODS: We analyzed 384 single nucleotide polymorphisms (SNPs) from 222 cardiovascular and metabolic genes in 87 outpatients with type 2 diabetes receiving thiazolidinedione therapy. Physiogenomic analysis was used to discover associations with body mass index (BMI) and edema. RESULTS: The 5 most significant gene associations found between BMI and SNPs were ADORA1, adenosine A1 receptor (rs903361, p<0.0003), PKM2, pyruvate kinase-muscle (rs2856929, p<0.002); ADIPOR2, adiponectin receptor 2 (rs7975375, p<0.007); UCP2, uncoupling protein 2 (rs660339, p<0.008); and APOH, apolipoprotein H (rs8178847, p<0.010). For edema, the 5 most significant gene associations were NPY, neuropeptide Y (rs1468271, p<0.006); GYS1, glycogen synthase 1-muscle (rs2287754, p<0.013); CCL2, chemokine C-C motif ligand 2 (rs3760396, p<0.015); OLR1, oxidized LDL receptor 1 (rs2742115, p<0.015); and GHRH, growth hormone releasing hormone (rs6032470, p<0.023). After accounting for multiple comparisons, ADORA1 was significantly associated with BMI at a false discovery rate (FDR) of <10%. CONCLUSION: Physiogenomic associations were discovered suggesting mechanistic links between adenosine signaling and BMI, and between vascular permeability and drug-induced edema.
BACKGROUND: Insulin resistance is a core feature of polycystic ovary syndrome (PCOS). Phosphatidylinositol (PI) 3-kinase is an important enzyme in the early insulin signaling cascade and plays a key role in insulin-mediated glucose transport. In its regulatory subunit, p85alpha, there is a common amino acid substitution (the Met326Ile polymorphism), and this amino acid may be crucial for the function of the p85alpha regulatory subunit and PI3-kinase. METHODS: Analysis of the Met326Ile polymorphism was carried out on DNA samples from 256 PCOS patients and 283 controls. Clinical and biochemical profiles of participants were also compared. RESULTS: The genotype distribution of the Met326Ile polymorphism in the PCOS group was not different from that of the controls (Met326Met/Met326Ile/Ile326Ile rates were 73.4%/23.4%/3.2% and 70.3%/26.1%/3.6% for the PCOS and control groups, respectively, P = 0.72). The PCOS group was divided into two subgroups according to the presence of the variant 326Ile allele. Compared with those carrying at least one variant 326Ile allele, carriers with the Met326Met genotype had higher serum 17-hydroxyprogesterone (17-OHP) {1.1 [95% confidence interval (CI) 1.1-1.3] ng/ml in those with the Met326Met genotype versus 0.8 (95% CI 0.7-1.0) ng/ml in those with Ile326Ile and Met326Ile genotypes, P = 0.0073} and free testosterone levels [1.2 (95% CI 1.1-1.4) pg/ml for Met326Met genotype versus 0.9 (95% CI 0.6-1.3) pg/ml for Ile326Ile and Met326Ile genotypes, P = 0.038]. CONCLUSIONS: Our results suggest that the PI3-kinase gene Met326Ile polymorphism may not be a major determinant for the development of PCOS, but it may modulate the concentrations of serum 17-OHP or free testosterone in PCOS patients.
Epo-induced endocytosis of EpoR plays important roles in the down-regulation of EpoR signaling and is the primary means that regulates circulating Epo concentrations. Here we show that cell-surface EpoR is internalized via clathrin-mediated endocytosis. Both JAK2 kinase activity and EpoR cytoplasmic tyrosines are important for ligand-dependent EpoR internalization. Phosphorylated Y429, Y431, and Y479 in the EpoR cytoplasmic domain bind p85 subunit of PI3 kinase on Epo stimulation and individually are sufficient to mediate Epo-dependent EpoR internalization. Knockdown of p85alpha and p85beta or expression of their dominant-negative forms, but not inhibition of PI3 kinase activity, dramatically impaired EpoR internalization, indicating that p85alpha and p85beta may recruit proteins in the endocytic machinery on Epo stimulation. Furthermore, mutated EpoRs from primary familial and congenital polycythemia (PFCP) patients lacking the 3 important tyrosines do not bind p85 or internalize on stimulation. Addition of residues encompassing Y429 and Y431 to these truncated receptors restored p85beta binding and Epo sensitivity. Our results identify a novel PI3 kinase activity-independent function of p85 in EpoR internalization and support a model that defects of internalization in truncated EpoRs from PFCP patients contribute to Epo hypersensitivity and prolonged signaling.
Cigarette smoking doubles the risk of pancreatic cancer, and smoking accounts for 20% to 25% of pancreatic cancers. The recent sequencing of the pancreatic cancer genome provides an unprecedented opportunity to identify mutational patterns associated with smoking. We previously sequenced >750 million bp DNA from 23,219 transcripts in 24 adenocarcinomas of the pancreas (discovery screen). In this previous study, the 39 genes that were mutated more than once in the discovery screen were sequenced in an additional 90 adenocarcinomas of the pancreas (validation screen). Here, we compared the somatic mutations in the cancers obtained from individuals who ever smoked cigarettes (n = 64) to the somatic mutations in the cancers obtained from individuals who never smoked cigarettes (n = 50). When adjusted for age and gender, analyses of the discovery screen revealed significantly more nonsynonymous mutations in the carcinomas obtained from ever smokers (mean, 53.1 mutations per tumor; SD, 27.9) than in the carcinomas obtained from never smokers (mean, 38.5; SD, 11.1; P = 0.04). The difference between smokers and nonsmokers was not driven by mutations in known driver genes in pancreatic cancer (KRAS, TP53, CDKN2A/p16, and SMAD4), but instead was predominantly observed in genes mutated at lower frequency. No differences were observed in mutations in carcinomas from the head versus tail of the gland. Pancreatic carcinomas from cigarette smokers harbor more mutations than do carcinomas from never smokers. The types and patterns of these mutations provide insight into the mechanisms by which cigarette smoking causes pancreatic cancer.
The NK cell-activating receptor NKG2D plays a critical role in the destruction of malignant cells, but many of the cell-signaling mechanisms governing NKG2D-mediated cellular cytotoxicity are unknown. We have identified an NKG2D-mediated signaling pathway that governs both conjugate formation and cytotoxic granule polarization. We demonstrate that an interaction between the regulatory subunit of PI3K, p85, and the adaptor protein CrkL is required for efficient NKG2D-mediated cellular cytotoxicity. We show decreased NK cell-target cell conjugate formation in NK cells treated with PI3K inhibitors or depleted of CrkL. Independent of adhesion, we find that microtubule organization center polarization toward target cells expressing the NKG2D ligand MICA or toward anti-NKG2D-coated beads is impaired in the absence of CrkL. Ab-stimulated granule release is also impaired in NK cells depleted of CrkL. Furthermore, our data indicate that the small Ras family GTPase Rap1 is activated downstream of NKG2D engagement in a PI3K- and CrkL-dependent manner and is required for conjugate formation, MTOC (microtubule organizing center) polarization, and NKG2D-dependent cellular cytotoxicity. Taken together, our data identify an NKG2D-activated signaling pathway that collectively orchestrates NK cell adhesion, cell polarization, and granule release.
Protein kinase C (PKC) superfamily play key regulatory roles on the development of cancer. However, the exact role of these enzymes in human hepatocellular carcinoma (HCC) has not been well established. Using the RT-PCR and Western blotting to analyze the levels of PKC isoforms mRNA and protein in the five different differentiated hepatoma cell lines, we found that PKC alpha was highly expressed in the poor-differentiated HCC cell lines (SK-Hep-1 and HA22T/VGH) as compared with that in the well-differentiated HCC cell lines (PLC/PRF/5, Hep3B, and HepG2). When treated with PKC alpha antisense oligonucleotides (ODN), both HA22T/VGH and SK-Hep-1 cells lines showed the reduction of PKC alpha expression, as well as a deceleration in the growth rate and in the level of cyclin D1, but the increase in the levels of p53 and p21(WAF1/CIP1). Moreover, the reduction of PKC alpha expression also inhibited the migratory and invasive potential of both HA22T/VGH and SK-Hep-1 cells lines, and revealed a down-regulation of several migration/invasion-related genes (MMP-1, u-PA, u-PAR, and FAK). These phenomenon were also confirmed by DNA-based small interfering RNA (siRNA) PKC alpha and PKC alpha/beta specific inhibitor Go6976. Thus, the results indicated that PKC alpha may be associated with regulation of cell proliferation/migration/invasion in human poorly differentiated HCC cells, suggesting a role for the PKC alpha in the malignant progression of human HCC.
Information on protein localization on the subcellular level is important to map and characterize the proteome and to better understand cellular functions of proteins. Here we report on a pilot study of 466 proteins in three human cell lines aimed to allow large scale confocal microscopy analysis using protein-specific antibodies. Approximately 3000 high resolution images were generated, and more than 80% of the analyzed proteins could be classified in one or multiple subcellular compartment(s). The localizations of the proteins showed, in many cases, good agreement with the Gene Ontology localization prediction model. This is the first large scale antibody-based study to localize proteins into subcellular compartments using antibodies and confocal microscopy. The results suggest that this approach might be a valuable tool in conjunction with predictive models for protein localization.
Plasmacytoid predendritic cells (pDCs) are the main producers of type I interferon (IFN) in response to Toll-like receptor (TLR) stimulation. Phosphatidylinositol-3 kinase (PI3K) has been shown to be activated by TLR triggering in multiple cell types; however, its role in pDC function is not known. We show that PI3K is activated by TLR stimulation in primary human pDCs and demonstrate, using specific inhibitors, that PI3K is required for type I IFN production by pDCs, both at the transcriptional and protein levels. Importantly, PI3K was not involved in other proinflammatory responses of pDCs, including tumor necrosis factor alpha and interleukin 6 production and DC differentiation. pDCs preferentially expressed the PI3K delta subunit, which was specifically involved in the control of type I IFN production. Although uptake and endosomal trafficking of TLR ligands were not affected in the presence of PI3K inhibitors, there was a dramatic defect in the nuclear translocation of IFN regulatory factor (IRF) 7, whereas nuclear factor kappaB activation was preserved. Thus, PI3K selectively controls type I IFN production by regulating IRF-7 nuclear translocation in human pDCs and could serve as a novel target to inhibit pathogenic type I IFN in autoimmune diseases.
PURPOSE: The phosphatidylinositol 3-kinase signaling pathway is frequently activated in cancer. Emerging evidence supports the p85alpha regulatory subunit gene, PIK3R1, as a novel oncogene. EXPERIMENTAL DESIGN: We examined the association of a functional missense polymorphism (Met326Ile) of PIK3R1 with colon cancer risk in a population-based case-control study of 421 incident cases and 483 controls. RESULTS: In our base unconditional logistic regression model controlling for age, gender, and race, we observed a 47% increase in risk among those carrying one or two copies of the 326Ile variant (P = 0.01). Further adjustment for family history of colorectal cancer, body mass index, nonsteroidal anti-inflammatory drugs, smoking, alcohol consumption, and physical activity strengthened the association [odds ratio (OR), 1.73; 95% confidence interval (CI), 1.24-2.42, P = 0.001]. The association was more pronounced among those older than 64 years (OR, 2.10; 95% CI, 1.19-3.70, P = 0.01). Evaluation of the genotypes assuming an additive mode of inheritance showed a significant trend for gene-dose response, where compared with Met/Met, the OR estimates for Ile/Met and Ile/Ile were 1.68 (95% CI, 1.19-2.37) and 2.27 (95% CI, 0.98-5.29), respectively (P for trend = 0.001). CONCLUSIONS: This study is the first to describe a significant association between a germ line functional variant in PIK3R1 and cancer, providing new evidence supporting a role for PIK3R1 in the development of colon cancer.
OBJECTIVE: To investigate polymorphisms in postinsulin receptor signaling. To investigate PIK3R1, SLC2A4, SLC2A4RG, and MEF2A to determine whether these genes are associated with susceptibility to polycystic ovary syndrome (PCOS) or key phenotypic features of insulin resistance in subjects with PCOS. DESIGN: Case-control study. SETTING: Participants with PCOS were recruited from a clinical practice database, and controls from the general community. PATIENT(S): One hundred seventy-three patients with PCOS conforming to the National Institutes of Health (NIH) diagnostic criteria, all of Caucasian descent; 107 normally ovulating women of white descent from the general community. INTERVENTION(S): Drawing of blood for DNA extraction. MAIN OUTCOME MEASURE(S): Frequency of PIK3R1, SLC2A4, SLC2A4RG, and MEF2A polymorphisms in case and control subjects. RESULT(S): No significant difference between the frequency of the polymorphisms in case and control women was identified. No single nucleotide polymorphism studied in any of these four genes was associated with the PCOS phenotype. CONCLUSION(S): Polymorphisms in the PIK3R1, SLC2A4, SLC2A4RG, and MEF2A genes are not associated with key PCOS phenotypes.
Invasion of surrounding brain tissue by isolated tumor cells represents one of the main obstacles to a curative therapy of glioblastoma multiforme. Here we unravel a mechanism regulating glioma infiltration. Tumor interaction with the surrounding brain tissue induces CD95 Ligand expression. Binding of CD95 Ligand to CD95 on glioblastoma cells recruits the Src family member Yes and the p85 subunit of phosphatidylinositol 3-kinase to CD95, which signal invasion via the glycogen synthase kinase 3-beta pathway and subsequent expression of matrix metalloproteinases. In a murine syngeneic model of intracranial GBM, neutralization of CD95 activity dramatically reduced the number of invading cells. Our results uncover CD95 as an activator of PI3K and, most importantly, as a crucial trigger of basal invasion of glioblastoma in vivo.
BACKGROUND: While the phosphatidylinositol 3-kinase (PI3K)-dependent signaling pathway is typically known to regulate cell growth and survival, emerging evidence suggest a role for this pathway in regulating the behavioural responses to addictive drugs. METHODOLOGY/PRINCIPAL FINDINGS: To investigate whether PI3K contributes to patterns of risky alcohol drinking in human, we investigated genetic variations in PIK3R1, encoding the 85 kD regulatory subunit of PIK, in 145 family trios consisting of 15-16 year old adolescents and their parents. Screening for mutations in exons, exon-intron boundaries and regulatory sequences, we identified 14 single nucleotide polymorphisms (SNPs) in the PIK3R1 gene region from exon 1 to the beginning of the 3' untranslated region (UTR). These SNPs defined haplotypes for the respective PIK3R1 region. Four haplotype tagging (ht)SNPs (rs706713, rs2302975, rs171649 and rs1043526), discriminating all haplotypes with a frequency >or=4.5% were identified. These htSNPs were used to genotype adolescents from the "Mannheim Study of Risk Children" (MARC). Transmission disequilibrium tests in these adolescents and their parents demonstrated sex-specific association of two SNPs, rs2302975 and rs1043526, with patterns of risky alcohol consumption in male adolescents, including lifetime prevalence of drunkenness (p = 0.0019 and 0.0379, respectively) and elevated maximum amount of drinking (p = 0.0020 and 0.0494, respectively), as a measure for binge drinking pattern. CONCLUSIONS/SIGNIFICANCE: Our findings highlight a previously unknown relevance of PIK3R1 genotypes for alcohol use disorders and might help discriminate individuals at risk for alcoholism.
Phosphoinositide 3-OH kinases (PI3Ks) are a group of major intracellular signaling molecules. In our previous study, we found that inhibition of PI3K activity suppressed the androgen receptor (AR)-mediated gene expression in prostate cancer cells. The AR has been considered as a critical determinant for the development and progression of human prostate cancers. In this study, we sought to identify the PI3K isoforms involved in AR transactivation. Using a gene-specific small interference RNA (siRNA) approach, we determined that the regulatory isoform p85alpha and the catalytic isoform p110beta, but not p110alpha, were required for androgen-stimulated AR transactivation and cell proliferation in prostate cancer cells. Consistently, overexpression of wild-type p110beta but not p110alpha gene led to androgen-independent AR transactivation. Silencing p110beta gene in prostate cancer cells abolished tumor growth in nude mice. Of the dual (lipid and protein) kinase activities, p110beta's lipid kinase activity was required for AR transactivation. Further analysis by a chromatin immunoprecipitation assay showed that p110beta is indispensable for androgen-induced AR-DNA interaction. Finally, gene expression analysis of clinical specimens showed that both p85alpha and p110beta were highly expressed in malignant prostate tissues compared to the nonmalignant compartments, and their expression levels correlated significantly with disease progression. Taken together, our data demonstrated that p85alpha and p110beta are essential for androgen-stimulated AR transactivation, and their aberrant expression or activation might play an important role in prostate cancer progression.
Fibroblast growth factor receptor (FGFR) signaling plays an important role in skeletogenesis. The molecular mechanisms triggered by activated FGFR in bone forming cells are however not fully understood. In this study, we identify a role for phosphatidylinositol 3-kinase (PI3K) signaling in cell apoptosis induced by FGFR2 activation in osteoblasts. We show that FGFR2 activation leads to decrease PI3K protein levels, resulting in attenuation of PI3K signaling in human osteoblasts. Biochemical and molecular analyses revealed that the attenuated PI3K signaling induced by FGFR2 activation is due to increased Cbl-PI3K molecular interaction mediated by the Cbl Y731 residue, which results in increased PI3K ubiquitination and proteasome degradation. Biochemical and immunocytochemical analyses showed that FGFR2 and Cbl interact in raft micro-domains at the plasma membrane. FGFR2 activation increases FGFR2 and Cbl recruitment in micro-domains, resulting in increased molecular interactions. Consistently, functional analyses showed that the attenuation of PI3K/Akt signaling triggered by FGFR2 activation results in increased osteoblast apoptosis. These results identify a functional molecular mechanism by which activated FGFR2 recruits Cbl in raft micro-domains to trigger PI3K ubiquitination and proteasome degradation, and reveal a novel role for PI3K/Akt attenuation in the control of osteoblast survival by FGFR2 signaling.
Phosphatidylinositide-3-kinases (PI3K) initiate a number of signaling pathways by recruiting other kinases, such as Akt, to the plasma membrane. One of the isoforms, PI3Kalpha, is an oncogene frequently mutated in several cancer types. These mutations increase PI3K kinase activity, leading to increased cell survival, cell motility, cell metabolism, and cell cycle progression. The structure of the complex between the catalytic subunit of PI3Kalpha, p110alpha, and a portion of its regulatory subunit, p85alpha reveals that the majority of the oncogenic mutations occur at the interfaces between p110 domains and between p110 and p85 domains. At these positions, mutations disrupt interactions resulting in changes in the kinase domain that may increase enzymatic activity. The structure also suggests that interaction with the membrane is mediated by one of the p85 domains (iSH2). These findings may provide novel structural loci for the design of new anti-cancer drugs.
Influenza A virus infection activates the phosphatidylinositol 3-kinase (PI3K)/Akt pathway by binding influenza A virus NS1 protein to the p85beta regulatory subunit of PI3K. In this study, we report that NS1 binds to the inter-SH2 (iSH2) domain of p85beta. Mutational analyses on p85beta iSH2 domain defined that Val-573 is the critical amino acid (AA) that mediates NS1 and p85beta interaction. In reciprocal gain of function experiments with p85alpha, we demonstrated that mutation to Val at Met-582 leads to NS1 binding and increased PI3K activity. Molecular modeling based on our experimental results suggested that, in addition to the interaction interface between the NS1 SH3 binding motif 1 (AA 164-167) and p85beta Val-573, AA 137-142 in NS1 might interact with p85beta. Indeed, mutations of AA 141 and 142 in NS1 disrupted the interaction between NS1 and p85beta. Mutant virus PR8-NS1-141/142 was not able to activate Akt phosphorylation. Furthermore, PI3K assays demonstrated that, in wild-type virus-infected cells, p85beta-associated PI3K activity was increased significantly. In contrast, in the mutant virus-infected cells containing mutant NS1 unable to interact with p85beta, the p85beta-associated PI3K activity up-regulation was not seen, suggesting that PI3K up-regulation is dependent upon the interaction between NS1 and p85beta. Competition experiments and the immunoprecipitation studies demonstrated that NS1, p85beta, and p110 form a complex in cells. Finally, the mechanism by which binding of NS1 to p85beta regulates PI3K activity was discussed based on a predicted structural model of NS1-p85-p110 complex.
The known genetic variants determining plasma HDL cholesterol (HDL-C) levels explain only part of its variation. Three hundred eighty-four single nucleotide polymorphisms (SNPs) across 251 genes based on pathways potentially relevant to HDL-C metabolism were selected and genotyped in 3,575 subjects from the Doetinchem cohort, which was examined thrice over 11 years. Three hundred fifty-three SNPs in 239 genes passed the quality-control criteria. Seven SNPs [rs1800777 and rs5882 in cholesteryl ester transfer protein (CETP); rs3208305, rs328, and rs268 in LPL; rs1800588 in LIPC; rs2229741 in NRIP1] were associated with plasma HDL-C levels with false discovery rate (FDR) adjusted q values (FDR_q) < 0.05. Five other SNPs (rs17585739 in SC4MOL, rs11066322 in PTPN11, rs4961 in ADD1, rs6060717 near SCAND1, and rs3213451 in MBTPS2 in women) were associated with plasma HDL-C levels with FDR_q between 0.05 and 0.2. Two less well replicated associations (rs3135506 in APOA5 and rs1800961 in HNF4A) known from the literature were also observed, but their significance disappeared after adjustment for multiple testing (P = 0.008, FDR_q = 0.221 for rs3135506; P = 0.018, FDR_q = 0.338 for rs1800961, respectively). In addition to replication of previous results for candidate genes (CETP, LPL, LIPC, HNF4A, and APOA5), we found interesting new candidate SNPs (rs2229741 in NRIP1, rs3213451 in MBTPS2, rs17585739 in SC4MOL, rs11066322 in PTPN11, rs4961 in ADD1, and rs6060717 near SCAND1) for plasma HDL-C levels that should be evaluated further.
Caspase 8 is a cysteine protease that initiates apoptotic signaling via the extrinsic pathway in a manner dependent upon association with early endosomes. Previously, we identified caspase 8 as an effector of migration, promoting motility in a manner dependent upon phosphorylation on Tyr-380 by Src family kinases and its subsequent association with Src homology 2 domain-containing proteins. Here we demonstrate the regulation of the small GTPase Rab5, which mediates early endosome formation, homotypic fusion, and maturation by caspase 8. Regulation requires the Tyr-380 phosphorylation site but not caspase proteolytic activity. Tyr-380 is essential for interaction with the Src homology 2 domains of p85alpha, a multifunctional adaptor for phosphatidylinositol 3-kinase, that possesses Rab-GAP activity. Interaction between caspase 8 and p85alpha promotes Rab5 GTP loading, alters endosomal trafficking, and results in the accumulation of Rab5-positive endosomes at the edge of the cell. Conversely, caspase 8-dependent GTP loading of Rab5 is overcome by increased expression of p85alpha in a Rab-GAP-dependent manner. Thus, we demonstrate a novel function for caspase 8 as a modulator of p85alpha Rab-GAP activity and endosomal trafficking.
Activation of intracellular signaling pathways by growth factors is one of the major causes of cancer development and progression. Recent studies have demonstrated that monomeric G proteins of the Ras family are key regulators of cell proliferation, migration, and invasion. Using an invasive breast cancer cell lines, we demonstrate that the ADP-ribosylation factor 1 (ARF1), a small GTPase classically associated with the Golgi, is an important regulator of the biological effects induced by epidermal growth factor. Here, we show that this ARF isoform is activated following epidermal growth factor stimulation and that, in MDA-MB-231 cells, ARF1 is found in dynamic plasma membrane ruffles. Inhibition of endogenous ARF1 expression results in the inhibition of breast cancer cell migration and proliferation. The underlying mechanism involves the activation of the phosphatidylinositol 3-kinase pathway. Our data demonstrate that depletion of ARF1 markedly impairs the recruitment of the phosphatidylinositol 3-kinase catalytic subunit (p110alpha) to the plasma membrane, and the association of the regulatory subunit (p85alpha) to the activated receptor. These results uncover a novel molecular mechanism by which ARF1 regulates breast cancer cell growth and invasion during cancer progression.
Serine/threonine kinase Akt/PKB is known to regulate divergent cellular processes, including apoptosis, proliferation, differentiation, and metabolism. Akt is activated by a variety of stimuli, through such growth factor receptors as HER2, in phosphoinositide-3-OH kinase (PI3K)-dependent manner. A loss of phosphatase and tensin homolog deleted on chromosome 10 (PTEN) function also activates Akt. It has recently been shown that Akt activation is associated with a worse outcome among endocrine treated breast cancer patients and that it also inhibits the progesterone receptor (PR) expression via the PI3K/Akt pathway in breast cancer cells. Therefore, the PI3K/Akt signaling pathway has recently attracted considerable attention as a new target for effective therapeutic strategies. In the present study, we investigated the relationship between Akt activation and either HER2 overexpression or PTEN gene alteration, as well as the PR expression. We analyzed the incidence of LOH at the PTEN locus in 138 breast cancer patients, using our new system for microsatellite analysis, called high-resolution fluorescent microsatellite analysis (HRFMA). We showed Akt activation to significantly correlate with HER2 overexpression or LOH at the PTEN gene locus while inversely correlating with the PR expression. In addition, when LOH at the PTEN gene locus and HER2 overexpression occurred simultaneously, the incidence of Akt activation and reduced PR expression was significant. The association between Akt activation and PR negative expression was observed even in the ER-positive cases. Our results suggest that simultaneous PTEN LOH and HER2 overexpression enhances Akt activation and may thus lead to a negative PR expression.
Persistent activation of Stat5 is frequently found in hematologic neoplasms. Studies conducted with constitutively active Stat5 mutants (Stat51*6 and cS5F) have shown that deregulated Stat5 activity promotes leukemogenesis. To investigate the oncogenic properties of these mutants, we used cS5F-expressing bone marrow cells which induce a multilineage leukemia when transplanted into recipient mice. Here, we show by immunocytochemistry that cS5F is localized mainly in the cytoplasmic compartment of leukemic cells, suggesting that the transforming nature of cS5F may be associated with a cytoplasmic function. In support of this hypothesis, we found that cS5F forms a complex with the p85 subunit of the phosphatidylinositol 3-kinase (PI3-K) and the scaffolding adapter Gab2 in leukemic bone marrow cells, resulting in the activation of Akt/PKB, a crucial downstream target of PI3-K. By using transducible TAT-Gab2 or TAT-Akt recombinant proteins, we were able to demonstrate that activation of the PI3-kinase/Akt pathway by cS5F molecules through Gab2 is essential for induction of cell growth. We also found that persistently phosphorylated Stat5 in primary cells from patients with myeloid leukemias has a cytoplasmic localization. These data suggest that oncogenic Stat5 proteins exert dual transforming capabilities not only as transcriptional activators but also as cytoplasmic signaling effectors.
The interaction of human immunodeficiency virus type 1 (HIV-1) with CD4+ T lymphocytes is well studied and typically results in virally induced cytolysis. In contrast, relatively little is known concerning the interplay between HIV-1 and microglia. Recent findings suggest that, counter-intuitively, HIV-1 infection may extend the lifespan of microglia. We developed a novel cell line model system to confirm and mechanistically study this phenomenon. We found that transduction of a human microglial cell line with an HIV-1 vector results in a powerful cytoprotective effect following apoptotic challenge. This effect was reproduced by ectopic expression of a single virus-encoded protein, Tat. Subsequent studies showed that the pro-survival effects of intracellular Tat could be attributed to activation of the PI-3-kinase (PI3K)/Akt pathway in the microglial cell line. Furthermore, we found that expression of Tat led to decreased expression of PTEN, a negative regulator of the PI-3-K pathway. Consistent with this, decreased p53 activity and increased E2F activity were observed. Based on these findings, a model of possible regulatory circuits that intracellular Tat and HIV-1 infection engage during the cytoprotective event in microglia has been suggested. We propose that the expression of Tat may enable HIV-1 infected microglia to survive throughout the course of infection, leading to persistent HIV-1 production and infection in the central nervous system.
Insulin regulates apoB metabolism via activation of PI3K or regulation of MTP via MAPK/ERK signalling. SHP-2 enhances both pathways through increased IRS-1 phosphorylation. We hypothesized that variants in the SHP-2 gene PTPN11 and PI3K p85alpha subunit gene PIK3R1 may influence fasting levels of plasma apoB and/or LDL cholesterol. We tested association of tagging SNPs (tSNPs) in each gene with serum lipids in a large sample of unselected population-based Caucasian female twins (n=2771, mean age 47.4+/-12.5 years) and then tested interaction between tSNPs in determining apoB and LDL levels. PTPN11 tSNP rs11066322 was associated with apoB (P=0.007) and rs11066320 was associated with LDL cholesterol (P=0.016). PIK3R1 tSNP rs251406 was associated with apoB (P=0.0003) and rs706713 was associated with LDL cholesterol (P=0.009). PTPN11 tSNP rs11066322 interacted with PIK3R1 tSNP rs251406 in determining serum apoB levels (P=0.012) and with PIK3R1 tSNP rs40318 in determining LDL cholesterol levels (P=0.009). Association of single tSNPs with both apoB and LDL cholesterol as well as interactions between the two genes suggest that variants influencing SHP-2 activity may modulate the acute pathway by which insulin regulates these lipids.
The Wiskott-Aldrich syndrome protein (WASp) plays a major role in coupling T cell antigen receptor (TCR) stimulation to induction of actin cytoskeletal changes required for T cell activation. Here, we report that WASp inducibly binds the sorting nexin 9 (SNX9) in T cells and that WASp, SNX9, p85, and CD28 colocalize within clathrin-containing endocytic vesicles after TCR/CD28 costimulation. SNX9, implicated in clathrin-mediated endocytosis, binds WASp via its SH3 domain and uses its PX domain to interact with the phosphoinositol 3-kinase regulatory subunit p85 and product, phosphoinositol (3,4,5)P3. The data reveal ligation-induced CD28 endocytosis to be clathrin- and phosphoinositol 3-kinase-dependent and TCR/CD28-evoked CD28 internalization and NFAT activation to be markedly enhanced by SNX9 overexpression, but severely impaired by expression of an SNX9 mutant (SNX9DeltaPX) lacking p85-binding capacity. CD28 endocytosis and CD28-evoked actin polymerization also are impaired in WASp-deficient T cells. These findings suggest that SNX9 couples WASp to p85 and CD28 so as to link CD28 engagement to its internalization and to WASp-mediated actin remodeling required for CD28 cosignaling. Thus, the WASp/SNX9/p85/CD28 complex enables a unique interface of endocytic, actin polymerizing, and signal transduction pathways required for CD28-mediated T cell costimulation.
Calcium induces epidermal keratinocyte differentiation, but the mechanism is not completely understood. We have previously demonstrated that calcium-induced human keratinocyte differentiation requires an intracellular calcium rise caused by phosphatidylinositol 3-kinase (PI3K)-dependent activation of phospholipase C-gamma1. In this study we sought to identify the upstream signaling pathway necessary for calcium activation of PI3K and its subsequent activation of phospholipase C-gamma1. We found that calcium induces the recruitment of PI3K to the E-cadherin-catenin complex at the plasma membrane of human keratinocytes. Knocking-down E-cadherin, beta-catenin, or p120-catenin expression blocked calcium activation of PI3K and phospholipase C-gamma1 and calcium-induced keratinocyte differentiation. However, knocking-down gamma-catenin expression had no effect. Calcium-induced PI3K recruitment to E-cadherin stabilized by p120-catenin at the plasma membrane requires beta-catenin but not gamma-catenin. These data indicate that the recruitment of PI3K to the E-cadherin/beta-catenin/p120-catenin complex via beta-catenin at the plasma membrane is required for calcium-induced phospholipase C-gamma1 activation and, ultimately, keratinocyte differentiation.
BACKGROUND: Although various studies have stressed the role of phosphatase and tensin homologue deleted on chromosome 10 (PTEN)-PI3K-AKT pathway in the progression of melanocytic lesions, little is known about the expression pattern of PI3K in these lesions. OBJECTIVE: To investigate the expression pattern of PI3K in benign and dysplastic nevi, primary melanomas, and metastatic melanomas and the role of PTEN and PI3K in melanocytic tumor progression. METHODS: Tissue microarrays were constructed using formalin-fixed, paraffin-embedded archival tissue blocks from 89 melanocytic lesions: 17 benign nevi, 18 dysplastic nevi, 23 primary melanomas, and 31 metastatic melanomas. Expression of PTEN and PI3K (p85 and p110 subunits) was evaluated immunohistochemically, and the number of cells and labeling intensity were assessed semiquantitatively. RESULTS: Both benign and dysplastic nevi showed strong cytoplasmic staining with PTEN, which was subsequently less in melanomas and completely lost in the metastatic lesions. Eleven of 17 (64%) benign nevi, seven of 10 (70%) dysplastic nevi, four of 23 (17%) primaries, and one of 31 (3%) visceral or lymph node metastasis showed strong positivity. Loss of PTEN expression from benign and dysplastic nevi to melanoma was statistically significant (p=0.001). Although few cells showed reactivity for phosphoinositide 3-kinase (PI3 kinase)-p85 subunit, strong positivity was not detected in the cytoplasm of benign, malignant, or metastatic lesions, except for a single visceral metastasis. Three of 13 (23%) nevi showed positivity for the p110 subunit. No positivity was observed in the dysplastic nevi. Two of 22 (9%) melanomas, one of 14 (7%) visceral metastasis, and three of 12 (25%) lymph node metastasis showed strong positivity. There was no statistical difference in PI3 kinase expression in benign and malignant melanocytic lesions (p=0.2). CONCLUSION: PI3K is not overexpressed in melanocytic lesions.
High-density lipoprotein mediates a normal physiological process called reverse cholesterol transport. In this process, a scavenger receptor of the B class (SR-BI)/human homologue of SR-BI, CD36, and LIMPII analogous-1 (hSR-BI/CLA-1) facilitates the cellular uptake of cholesterol from high-density lipoprotein. In endothelial cells, high-density lipoprotein activates endothelial NO synthase via hSR-BI/CLA-1. Angiotensin II (Ang II) is a powerful accelerator of atherosclerosis and modulates the expression of endothelial NO synthase. In the present study, we have examined the role of Ang II on hSR-BI/CLA-1 expression in human umbilical vein endothelial cells. Our results showed that endogenous expression of hSR-BI/CLA-1 was suppressed by exposure to Ang II in human umbilical vein endothelial cells. Administration of the Ang II type-1 receptor blocker olmesartan inhibited Ang II-induced hSR-BI/CLA-1 protein repression. In Ang II-treated cells, high-density lipoprotein had no effect on endothelial NO synthase activation. Ang II decreased transcriptional activity of the hSR-BI/CLA-1 promoter. The inhibitory effect of Ang II on hSR-BI/CLA-1 promoter activity was abrogated by wortmannin and LY294002, specific inhibitors of phosphatidylinositol 3-kinase. Exposure of human umbilical vein endothelial cells to Ang II elicited a rapid phosphorylation of Akt and FoxO1, a known target of Akt signaling. Constitutively active Akt inhibits the activity of the hSR-BI/CLA-1 promoter, and a dominant-negative mutant of Akt or mutagenesis of a FoxO1 response element in the hSR-BI/CLA-1 abolished the ability of Ang II to suppress promoter activity. Together, these results indicate that the phosphatidylinositol 3-kinase/Akt/FoxO1 pathway participates in Ang II suppression of hSR-BI/CLA-1 expression and suggests that the endothelial receptor for hSR-BI/CLA-1 is downregulated by the renin-angiotensin system.
In macrophages, enzymes that synthesize or hydrolyze phosphatidylinositol (3,4,5)-trisphosphate [PI(3,4,5)P(3)] regulate Fcgamma receptor-mediated phagocytosis. Inhibition of phosphatidylinositol 3-kinase (PI3K) or overexpression of the lipid phosphatases phosphatase and tensin homologue (PTEN) and Src homology 2 domain-containing inositol phosphatase (SHIP-1), which hydrolyze PI(3,4,5)P(3) to phosphatidylinositol 4,5-bisphosphate and phosphatidylinositol 3,4-bisphosphate [PI(3,4)P(2)], respectively, inhibit phagocytosis in macrophages. To examine how these enzymes regulate phagosome formation, the distributions of yellow fluorescent protein (YFP) chimeras of enzymes and pleckstrin homology (PH) domains specific for their substrates and products were analyzed quantitatively. PTEN-YFP did not localize to phagosomes, suggesting that PTEN regulates phagocytosis globally within the macrophage. SHIP1-YFP and p85-YFP were recruited to forming phagosomes. SHIP1-YFP sequestered to the leading edge and dissociated from phagocytic cups earlier than did p85-cyan fluorescent protein, indicating that SHIP-1 inhibitory activities are restricted to the early stages of phagocytosis. PH domain chimeras indicated that early during phagocytosis, PI(3,4,5)P(3) was slightly more abundant than PI(3,4)P(2) at the leading edge of the forming cup. These results support a model in which phagosomal PI3K generates PI(3,4,5)P(3) necessary for later stages of phagocytosis, PTEN determines whether those late stages can occur, and SHIP-1 regulates when and where they occur by transiently suppressing PI(3,4,5)P(3)-dependent activities necessary for completion of phagocytosis.
In normal epithelial cells, cell-matrix interaction is required for cell survival and proliferation, whereas disruption of this interaction causes epithelial cells to undergo apoptosis called anoikis. Here we show that the small GTPase RhoG plays an important role in the regulation of anoikis. HeLa cells are capable of anchorage-independent cell growth and acquire resistance to anoikis. We found that RNA interference-mediated knockdown of RhoG promoted anoikis in HeLa cells. Previous studies have shown that RhoG activates Rac1 and induces several cellular functions including promotion of cell migration through its effector ELMO and the ELMO-binding protein Dock180 that function as a Rac-specific guanine nucleotide exchange factor. However, RhoG-induced suppression of anoikis was independent of the ELMO- and Dock180-mediated activation of Rac1. On the other hand, the regulation of anoikis by RhoG required phosphatidylinositol 3-kinase (PI3K) activity, and constitutively active RhoG bound to the PI3K regulatory subunit p85alpha and induced the PI3K-dependent phosphorylation of Akt. Taken together, these results suggest that RhoG protects cells from apoptosis caused by the loss of anchorage through a PI3K-dependent mechanism, independent of its activation of Rac1.
As insulin-like growth factor-1 (IGF-1) is present in the alpha granules of platelets and its receptor is expressed on the platelet surface, it may contribute to the amplification of platelet responses and pathogenesis of cardiovascular disease. The functional and signaling pathways that are involved in IGF-1 modulation of platelet function, however, are presently unknown. Here, I report that IGF-1 stimulation of platelets results in dose-dependent phosphorylation of the IGF receptor in the range of 1 to 100 nM. Phosphorylation of the IGF receptor is rapid and sustained, with maximal phosphorylation reached within 1 minute. Furthermore, IGF-1 stimulates tyrosine phosphorylation of insulin receptor substrate-1 (IRS-1) and IRS-2 and their association with the p85 subunit of phosphoinositide-3 kinase (PI3K). IGF-1-stimulated tyrosine phosphorylation of IRS-1 and IRS-2 and subsequent p85 binding is transient and precedes phosphorylation of protein kinase B (PKB) on Ser473. PAR-1-mediated platelet aggregation is potentiated by IGF-1 and this potentiation, together with PKB phosphorylation, is abolished by the PI3Kalpha inhibitors PI-103 and PIK-75. Importantly, the IGF receptor inhibitor NVP-AEW541 and the neutralization antibody alphaIR3 inhibit SFLLRN-stimulated aggregation, implicating IGF-1 in autocrine regulation of platelet function. These results demonstrate that IGF-1 activates the IGF receptor/IRS/PI3K/PKB pathway, and that PI3Kalpha is essential for the potentiatory effect of IGF-1 on platelet responses.
Lymphocyte recruitment to sites of inflammation involves a bidirectional series of cues between the endothelial cell (EC) and the leukocyte that culminate in lymphocyte migration into the tissue. Remodeling of the EC F-actin cytoskeleton has been observed after leukocyte adhesion, but the signals to the EC remain poorly defined. We studied the dependence of peripheral blood lymphocyte transendothelial migration (TEM) through an EC monolayer in vitro on EC phosphatidylinositol 3-kinase (PI 3-kinase) activity. Lymphocytes were perfused over cytokine-activated EC using a parallel-plate laminar flow chamber. Inhibition of EC PI 3-kinase activity using LY-294002 or wortmannin decreased lymphocyte TEM (48 +/- 6 or 34 +/- 7%, respectively, vs. control; mean +/- SE; P < 0.05). Similarly, EC knockdown of the p85alpha regulatory subunit of PI 3-kinase decreased lymphocyte transmigration. Treatment of EC with jasplakinolide to inhibit EC F-actin remodeling also decreased lymphocyte TEM to 24 +/- 10% vs. control (P < 0.05). EC PI 3-kinase inhibition did not change the strength of lymphocyte adhesion to the EC or formation of the EC "docking structure" after intercellular adhesion molecule-1 ligation, whereas this was inhibited by jasplakinolide treatment. A similar fraction of lymphocytes migrated on control or LY-294002-treated EC and localized to interendothelial junctions. However, lymphocytes failed to extend processes below the level of vascular endothelial (VE)-cadherin on LY-294002-treated EC. Together these observations indicate that EC PI 3-kinase activity and F-actin remodeling are required during lymphocyte diapedesis and identify a PI 3-kinase-dependent step following initial separation of the VE-cadherin barrier.
PIK3CA, one of the two most frequently mutated oncogenes in human tumors, codes for p110alpha, the catalytic subunit of a phosphatidylinositol 3-kinase, isoform alpha (PI3Kalpha, p110alpha/p85). Here, we report a 3.0 angstrom resolution structure of a complex between p110alpha and a polypeptide containing the p110alpha-binding domains of p85alpha, a protein required for its enzymatic activity. The structure shows that many of the mutations occur at residues lying at the interfaces between p110alpha and p85alpha or between the kinase domain of p110alpha and other domains within the catalytic subunit. Disruptions of these interactions are likely to affect the regulation of kinase activity by p85 or the catalytic activity of the enzyme, respectively. In addition to providing new insights about the structure of PI3Kalpha, these results suggest specific mechanisms for the effect of oncogenic mutations in p110alpha and p85alpha.
It is well established that CD21 activation on human B cell surface triggers B cell proliferation. We previously demonstrated that CD21 activation also triggers tyrosine phosphorylation of two components, p95 and p120, both interacting with SH2 domains of the p85 subunit of PI 3-kinase. We successively identified p95 as the nucleolin and the first signal transduction pathway specifically triggered by CD21 activation, i.e.: pp60Src activation, tyrosine phosphorylation of p95 nucleolin, its interaction with SH2 domains of p85 subunit and PI 3-kinase activation, followed by AKT-GSK-3 activations. We herein identified the p120 component as the protooncoprotein Cbl and the first steps associated to its activation. First, CD21 activation triggered Cbl tyrosine phosphorylation, which required c-Src kinase but not PI 3-kinase or Syk kinase activities. Involvement of Src kinase in this step was supported by inhibition of Cbl phosphorylation and its interactions with other components when cells were either preincubated with specific Src inhibitor or transfected with dominant-negative c-Src form. Second, once tyrosine phosphorylated, Cbl interacts with SH2 domains of p85 subunit, SH2 domains of Crk-L and with tyrosine phosphorylated Syk kinase. The third and unexpected feature was to found that, at the contrary of BCR or of CD19 (herein also analyzed for the first time), CD21 activation triggers dissociation of Cbl-Vav complex. Thus, these results provide the first molecular basis of a new signal transduction pathway specifically triggered by CD21 activation.
IGF-I stimulates smooth muscle cell (SMC) migration and the phosphatidylinositol-3 (PI-3) kinase pathway plays an important role in mediating the IGF-I-induced migratory response. Prior studies have shown that the tyrosine phosphatase Src homology 2 domain tyrosine phosphatase (SHP)-2 is necessary to activate PI-3 kinase in response to growth factors and expression of a phosphatase inactive form of SHP-2 (SHP-2/C459S) impairs IGF-I-stimulated cell migration. However, the mechanism by which SHP-2 phosphatase activity or the recruitment of SHP-2 to other signaling molecules contributes to IGF-I stimulated PI-3 kinase activation has not been determined. SMCs that had stable expression of SHP-2/C459S had reduced cell migration and Akt activation in response to IGF-I, compared with SMC-expressing native SHP-2. Similarly in cells expressing native SHP-2, IGF-I induced SHP-2 binding to p85, whereas in cells expressing SHP-2/C459S, there was no increase. Because the C459S substitution results in loss of the ability of SHP-2 to disassociate from its substrates, making it inaccessible not only to p85 but also the other proteins, a p85 mutant in which tyrosines 528 and 556 were changed to phenylalanines was prepared to determine whether this would disrupt the p85/SHP-2 interaction and whether the loss of this specific interaction would alter IGF-I stimulated the cell migration. Substitution for these tyrosines in p85 resulted in loss of SHP-2 recruitment and was associated with a reduction in association of the p85/p110 complex with insulin receptor substrate-1. Cells stably expressing this p85 mutant also showed a decrease in IGF-I-stimulated PI-3 kinase activity and cell migration. Preincubation of cells with a cell-permeable peptide that contains the tyrosine556 motif of p85 also disrupted SHP-2 binding to p85 and inhibited the IGF-I-induced increase in cell migration. The findings indicate that tyrosines 528 and 556 in p85 are required for SHP-2 association. SHP-2 recruitment to p85 is required for IGF-I-stimulated association of the p85/p110 complex with insulin receptor substrate-1 and for the subsequent activation of the PI-3 kinase pathway leading to increased cell migration.
The Src homology 2 (SH2) domains of the p85 subunit of phosphatidylinositol 3'-kinase have been shown to bind to the tyrosine-phosphorylated platelet-derived growth factor receptor (PDGFR). Previously, we have demonstrated that p85 SH2 domains can also bind to the serine/threonine kinase A-Raf via a unique phosphorylation-independent interaction. In this report, we describe a new phosphotyrosine-independent p85 SH2-binding protein, ankyrin 3 (Ank3). In general, ankyrins serve a structural role by binding to both integral membrane proteins at the plasma membrane and spectrin/fodrin proteins of the cytoskeleton. However, smaller isoforms of Ank3 lack the membrane domain and are localized to late endosomes and lysosomes. We found that p85 binds directly to these smaller 120- and 105-kDa Ank3 isoforms. Both the spectrin domain and the regulatory domain of Ank3 are involved in binding to p85. At least two domains of p85 can bind to Ank3, and the interaction involving the p85 C-SH2 domain was found to be phosphotyrosine-independent. Overexpression of the 120- or 105-kDa Ank3 proteins resulted in significantly enhanced PDGFR degradation and a reduced ability to proliferate in response to PDGF. Ank3 overexpression also differentially regulated signaling pathways downstream from the PDGFR. Chloroquine, an inhibitor of lysosomal-mediated degradation pathways, blocked the ability of Ank3 to enhance PDGFR degradation. Immunofluorescence experiments demonstrated that both small Ank3 isoforms colocalized with the lysosomal-associated membrane protein and with p85 and the PDGFR. These results suggest that Ank3 plays an important role in lysosomal-mediated receptor down-regulation, likely through a p85-Ank3 interaction.
Gastrin-releasing peptide (GRP) activates phosphatidylinositol 3-kinase (PI3-K)/Akt, an important cell survival signaling pathway, to stimulate growth of various cell types. Transforming growth factor (TGF) superfamily ligands activate intracellular Smad signaling to regulate cell growth, differentiation and apoptosis; dysregulation of the TGF-beta/Smad pathway has been noted in cancer cells. Therefore, we sought to determine whether a potential cross-talk exists between the TGF-beta/Smad and PI3-K pathways in the regulation of neuroblastoma cell growth. Increased Smad DNA binding was noted in SK-N-SH human neuroblastoma cells when treated with LY294002, an inhibitor of PI3-K, by transcription factor/DNA array analysis and electrophoretic mobility shift assay. LY294002 treatment resulted in Smad2 accumulation in the nuclei and an increased Smad binding element (SBE)-luciferase activity. These findings were corroborated by co-transfection with pCGNN-Deltap85 plasmid, which expresses a PI3-K mutant p85 subunit. In contrast, GRP treatment decreased Smad binding activity in neuroblastoma cells. Our findings demonstrate that the PI3-K pathway negatively regulates TGF-beta/Smad signaling in neuroblastoma cells. GRP-induced activation of PI3-K, resulting in neuroblastoma cell growth promotion, is potentiated by down-regulation of TGF-beta/Smad signaling.
AIMS/HYPOTHESIS: We sought to define early molecular alterations associated with nutritionally induced insulin resistance in humans. METHODS: Insulin sensitivity was assessed using a hyperinsulinaemic-euglycaemic clamp in eight healthy women while on an isocaloric diet and after 3 days of overfeeding (50% above eucaloric diet). Expression of phosphatidylinositol (PI) 3-kinase subunits p85alpha and p110 was assessed and measurements were made of IRS-1-associated PI 3-kinase activity, tyrosine and serine phosphorylation of IRS-1, and serine and threonine phosphorylation of p70S6 kinase. Measurements were made in skeletal muscle biopsies obtained before and after overfeeding. RESULTS: Three days of overfeeding resulted in a reduction of insulin sensitivity accompanied by: (1) increased expression of skeletal muscle p85alpha; (2) an alteration in the ratio of p85alpha to p110; (3) a decrease in the amount of IRS-1-associated p110; and (4) a decrease in PI 3-kinase activity. Increases in expression of p85alpha and in the p85alpha:p110 ratio demonstrated a highly significant inverse correlation with insulin sensitivity, and changes in PI 3-kinase activity correlated with changes in insulin sensitivity. Tyrosine and serine phosphorylation of IRS-1 and serine and threonine phosphorylation of p70S6 kinase were unaffected by 3 days of overfeeding. CONCLUSIONS/INTERPRETATION: We identified a novel mechanism of nutritionally induced insulin resistance in healthy women of normal weight. We conclude that increased expression of p85alpha may be one of the earliest molecular alterations in the mechanism of the insulin resistance associated with overfeeding.
The molecular mechanism of the human immunodeficiency virus type 1 (HIV-1) gp120-induced apoptosis of bystander T cells is not well defined. Here, we demonstrate that CD45, a key component of the T cell receptor pathway, plays a crucial role in apoptosis induced by HIV-1 gp120. We observed that HIV-1 gp120-induced apoptosis was significantly reduced in a CD45-deficient cell line and that reconstitution of CD45 in these cells restored gp120-induced apoptosis. However, expression of a chimeric protein containing only the intracellular phosphatase domain was not able to restore the apoptotic function in the CD45-negative clone, indicating an important role for the extracellular domain of CD45 in this function. The role of CD45 in gp120-induced apoptosis was further confirmed in T cell lines and peripheral blood mononuclear cells using a selective CD45 inhibitor as well as CD45-specific small interfering RNA. We also observed that gp120 treatment induced CD45 association with the HIV coreceptor CXCR4. Further elucidation of downstream signaling events revealed that CD45 modulates HIV-1 gp120-induced apoptosis by regulating Fas ligand induction and activation of the phosphoinositide 3-kinase/Akt pathway. These results suggest a novel CD45-mediated mechanism for the HIV envelope-induced apoptosis of T cells.
Bacterial flagellin, recognized by Toll-like receptor (TLR) 5, is suggested to be involved in colonic inflammation. However, the detailed signaling mechanisms mediated by flagellin/TLR5 engagement are not clear. Here we dissected the biochemical mechanism by which TLR5 engagement mediates phosphatidylinositol 3-kinase (PI3K) activation in colonic epithelial cells. We demonstrate that silencing TLR5 expression in nontransformed human colonic epithelial cells blocks flagellin-induced PI3K activation, indicating specific activation of PI3K by flagellin/TLR5 engagement. Moreover, we determine that TLR5 recruits the p85 regulatory subunit of PI3K to its cytoplasmic TIR domain in response to flagellin. However, the Src homology binding "YXXM" motif in the cytoplasmic TIR domain of TLR5 is not involved in p85 recruitment, implying that TLR5 indirectly recruits p85. Indeed, we demonstrate that the adaptor molecule MyD88 associates with TLR5 and silencing MyD88 expression blocks PI3K activation by disrupting the association between TLR5 and p85. Furthermore, we show that MyD88 associates with p85 in response to flagellin. Additionally, we determine that blocking PI3K activation reduces interleukin-8 production induced by flagellin in human colonic epithelial cells. Together, MyD88 bridges TLR5 engagement to PI3K activation in response to flagellin.
Thyroid hormones affect cardiac growth and phenotype; however, the mechanisms by which the hormones induce cardiomyocyte hypertrophy remain uncharacterized. Tri-iodo-L-thyronine (T3) treatment of cultured cardiomyocytes for 24 h resulted in a 41 +/- 5% (p < 0.001) increase in [(3)H]leucine incorporation into total cellular protein. This response was abrogated by the phosphatidylinositol 3-kinase (PI3K) inhibitor, wortmannin. Co-immunoprecipitation studies showed a direct interaction of cytosol-localized thyroid hormone receptor TRalpha1 and the p85alpha subunit of PI3K. T3 treatment rapidly increased PI3K activity by 52 +/- 3% (p < 0.005), which resulted in increased phosphorylation of downstream kinases Akt and mammalian target of rapamycin (mTOR). This effect was abrogated by pretreatment with wortmannin or LY294002. Phosphorylation of p70(S6K), a known target of mTOR, occurred rapidly following T3 treatment and was inhibited by rapamycin and wortmannin. In contrast, phosphorylation of the p85 variant of S6K in response to T3 was not blocked by LY294002, wortmannin, or rapamycin, thus supporting a T3-activated pathway independent of PI3K and mTOR. 40 S ribosomal protein S6, a target of p70(S6K), and 4E-BP1, a target of mTOR, were both phosphorylated within 15-25 min of T3 treatment and could be inhibited by wortmannin and rapamycin. Thus, rapid T3-mediated activation of PI3K by cytosolic TRalpha1 and subsequent activation of the Akt-mTOR-S6K signaling pathway may underlie one of the mechanisms by which thyroid hormone regulates physiological cardiac growth.
Phosphoinositide 3-kinase (PI3K) mediates essential functions of vascular endothelial growth factor (VEGF), including the stimulation of endothelial cell proliferation and migration. Nevertheless, the mechanisms coupling the receptor VEGFR-2 to PI3K remain obscure. We observed that the Grb2-bound adapter Gab1 is tyrosine-phosphorylated and relocated to membrane fractions upon VEGF stimulation of endothelial cells. We could detect the PI3K regulatory subunit p85 in immunoprecipitates of endogenous Gab1, and vice versa, and measure a Gab1-associated lipid kinase activity upon VEGF stimulation. Furthermore, transfection of the Gab1-YF3 mutant lacking all p85-binding sites strongly repressed PI3K activation measured in vitro. Moreover, Gab1-YF3 severely decreased the cellular amount of phosphatidylinositol 3,4,5-trisphosphate (PtdIns(3,4,5)P3) generated in response to VEGF. Furthermore, adenoviral expression of Gab1-YF3 suppressed both Akt phosphorylation and recovery of wounded human umbilical vein endothelial cell monolayers, a VEGF-dependent process involving cell migration and proliferation under PI3K control. Transfection of other Gab1 mutants, lacking Grb2-binding sites or the pleckstrin homology (PH) domain, also prevented Akt activation, further demonstrating Gab1 involvement in PI3K activation. These mutants were also used to show that interactions with both Grb2 and PtdIns(3,4,5)P3 mediate Gab1 recruitment by VEGFR-2. Importantly, Gab1 mobilization was impaired by (i) PI3K inhibitors, (ii) deletion of Gab1 PH domain, (iii) PTEN (phosphatase and tensin homolog deleted on chromosome 10) overexpression to repress PtdIns(3,4,5)P3 production, and (iv) overexpression of a competitor PH domain for PtdIns(3,4,5)P3 binding, which altogether demonstrated that PI3K is also an upstream regulator of Gab1. Gab1 thus appears as a primary actor in coupling VEGFR-2 to PI3K/Akt, recruited through an amplification loop involving PtdIns(3,4,5)P3 and its PH domain.
Hsp90 plays an essential role in maintaining stability and activity of its clients, including oncogenic signaling proteins that regulate key signal transduction nodes. Hsp90 inhibitors interfere with diverse signaling pathways by destabilizing and attenuating activity of such proteins, and thus they exhibit antitumor activity. However, Hsp90 inhibition has recently been reported to activate Akt and Erk and potentiate Akt activation induced by insulin-like growth factor 1 and insulin, raising the concern that clinical use of Hsp90 inhibitors might promote tumor progression under certain circumstances. Here, we show that the prototypical Hsp90 inhibitor geldanamycin induces Akt and Erk activation that is independent of PTEN status and is mediated by transient activation of Src kinase. Activated Src phosphorylates Cbl, which recruits the p85 subunit of phosphatidylinositol 3-kinase, resulting in phosphatidylinositol 3-kinase activation and eventually the activation of Akt and Erk. We show that geldanamycin rapidly disrupts Src association with Hsp90, suggesting that Src activation results directly from dissociation of the chaperone. These data suggest that, under certain circumstances, dual inhibition of Hsp90 and Src may be warranted.
Fc gamma receptors (FcgammaRs) contribute to the internalization of large and small immune complexes through phagocytosis and endocytosis, respectively. The molecular processes underlying these internalization mechanisms differ dramatically and have distinct outcomes in immune clearance and modulation of cell function. However, it is unclear how the same receptors (FcgammaR) binding to identical ligands (IgG) can elicit such distinct responses. We and others have shown that Syk kinase, Src-related tyrosine kinases (SRTKs) and phosphatidyl inositol 3-kinases (PI3K) play important roles in FcgammaR phagocytosis. Herein, we demonstrate that these kinases are not required for FcgammaR endocytosis. Endocytosis of heat-aggregated IgG (HA-IgG) by COS-1 cells stably transfected with FcgammaRIIA or chimeric FcgammaRI-gamma-gamma (EC-TM-CYT) was not significantly altered by PP2, piceatannol, or wortmannin. In contrast, phagocytosis of large opsonized particles (IgG-sensitized sheep erythrocytes, EA) was markedly reduced by these inhibitors. These results were confirmed in primary mouse bone marrow-derived macrophages and freshly isolated human monocytes. Levels of receptor phosphorylation were similar when FcgammaRIIA was cross-linked using HA-IgG or EA. However, inhibition of FcgammaR phosphorylation prevented only FcgammaR phagocytosis. Finally, biochemical analyses of PI3K(p85)-Syk binding indicated that direct interactions between native Syk and PI3K proteins are differentially regulated during FcgammaR phagocytosis and endocytosis. Overall, our results indicate that FcgammaR endocytosis and phagocytosis differ dramatically in their requirement for Syk, SRTKs, and PI3K, pointing to striking differences in their signal transduction mechanisms. We propose a competitive inhibition-based model in which PI3K and c-Cbl play contrasting roles in the induction of phagocytosis or endocytosis signaling cascades.
Autotaxin, a lysophospholipase D producing lysophosphatidic acid, augments invasive and metastatic potential of tumor cells. Current investigations have focused on understanding the molecular mechanisms by which autotaxin regulates the expression of a major mediator of tumor invasion and metastasis, urokinase-type plasminogen activator (uPA) in human A2058 melanoma cells. Autotaxin induced uPA expression in a dose-dependent manner that was inhibited by pharmacological inhibitors for Gi (pertussis toxin), phosphoinositide 3-kinase (PI3K, LY294002), Akt inhibitor (AktI), proteosome activity and IkappaB phosphorylation (pyrrolidine dithiocarbamate), and by a dominant negative mutant (DN) of Akt. Autotaxin phosphorylated Akt and induced the translocation of nuclear [corrected] factor-kappaB (NF-kappaB) to the nucleus that were inhibited by AktI or by overexpressing DN-Akt. Consistently, green fluorescence protein-tagged p65 of NF-kappaB accumulated in the nucleus by autotaxin that was abrogated when the cells were transfected with DN-Akt. Moreover, autotaxin increased the DNA binding ability of NF-kappaB and promoter activity of uPA. Collectively, these data strongly suggest autotaxin induces uPA expression via the Gi-PI3K-Akt-NF-kappaB signaling pathway that might be critical for autotaxin-induced tumor cell invasion and metastasis.
AIMS/HYPOTHESIS: Phosphatidylinositol 3-kinase (PI3K) couples the leptin and insulin signalling pathways via the insulin receptor substrates IRS1 and IRS2. Hence, defective activation of PI3K could be a novel mechanism of peripheral leptin or insulin resistance. We investigated associations of tagging single-nucleotide polymorphisms (tSNPs) in the PI3K p85alpha regulatory subunit gene PIK3R1 with anthropometry, leptin, body fat and insulin sensitivity in a female twin population of European extraction. MATERIALS AND METHODS: Eight tSNPs were genotyped in 2,778 women (mean age 47.4+/-12.5 years) from the St Thomas' UK Adult Twin Registry (Twins UK). RESULTS: SNP rs1550805 was associated with serum leptin (p=0.028), BMI (p=0.025), weight (p=0.019), total fat (p=0.004), total fat percentage (p=0.002), waist circumference (p=0.025), central fat (p=0.005) and central fat percentage (p=0.005). SNPs rs7713645 and rs7709243 were associated with BMI (p=0.020 and p=0.029, respectively), rs7709243 with weight, total and central fat (p=0.026, p=0.031 and p=0.023, respectively) and both SNPs with fasting glucose (p=0.003 and p=0.001, respectively) and glucose 2-h post OGTT (p=0.023 and p=0.007, respectively). Subjects with haplotype 222 (frequency 7.2%) showed higher serum leptin concentration (p=0.007) and body fat measures (p< or =0.001 for all), and those with haplotype 221 (frequency 38.7%) showed higher fasting and 2-h glucose (p=0.035 and p=0.021, respectively) compared with subjects with the most common haplotype, 111 (frequency 45.5%). CONCLUSIONS/INTERPRETATION: Association of the PIK3R1 SNP rs1550805 with serum leptin and body fat may reflect a diminished ability of PI3K to signal via IRS1 or IRS2 in response to leptin.
After engagement of the B cell receptor for antigen, the Syk protein-tyrosine kinase becomes phosphorylated on multiple tyrosines, some of which serve as docking sites for downstream effectors with SH2 or other phosphotyrosine binding domains. The most frequently identified binding partner for catalytically active Syk identified in a yeast two-hybrid screen was the p85 regulatory subunit of phosphoinositide 3-kinase. The C-terminal SH2 domain of p85 was sufficient for mediating an interaction with tyrosine-phosphorylated Syk. Interestingly, this domain interacted with Syk at phosphotyrosine 317, a site phosphorylated in trans by the Src family kinase, Lyn, and identified previously as a binding site for c-Cbl. This site interacted preferentially with the p85 C-terminal SH2 domain compared with the c-Cbl tyrosine kinase binding domain. Molecular modeling studies showed a good fit between the p85 SH2 domain and a peptide containing phosphotyrosine 317. Tyr-317 was found to be essential for Syk to support phagocytosis mediated by FcgammaRIIA receptors expressed in a heterologous system. These studies establish a new type of p85 binding site that can exist on proteins that serve as substrates for Src family kinases and provide a molecular explanation for observations on direct interactions between Syk and phosphoinositide 3-kinase.
Although insulin receptor (InsR) and type I insulin-like growth factor receptor (IGF-IR) elicit different physiological effects in their target tissues, their signaling capabilities are similar to a large extent. In the present work, we investigated the potential of the third member of the family, insulin receptor-related receptor (IRR), to associate with known interaction partners of the InsR and the IGF-I receptor in a yeast two-hybrid assay. Using the intracellular part of the IRR we found no association with any of the tested signaling molecules. Phosphotyrosine detection revealed a lack in the constitutive activation of the IRR described for analogous constructs of the two other members of the family. Replacement of the kinase domain of the IGF-IR or its C-terminal lobe alone into the IRR caused a complete restoration of the tyrosine phosphorylation of the IRR. The reestablishment of autophosphorylation was paralleled by restoration of interaction with a specific range of signaling molecules.
The Human Immunodeficiency Virus -1 (HIV-1) Nef protein that was originally identified as a viral negative factor is a 27kDa myristoylated protein. However, this so called dispensable viral protein has emerged as one of the most important proteins for viral life cycle. Nef not only establishes the host cell environment suitable for viral replication and pathogenesis but also facilitates the progression of the infection into disease. Previous efforts have been focussed to explain how Nef down modulates host cell receptors like CD4 and MHC-1 molecules, thereby helping the virus to evade host defense and to increase viral infectivity. Nef also ably modulates specific processes like apoptosis in favour of viral life cycle other than being the stimulus for cell activation and signal transduction pathways. After much maligning over its reported positive or negative functions on the HIV-1 Long Terminal Repeat (LTR) promoter, the Nef protein is now perceived to enhance viral replication and infection through a combination of different effector functions. Recent reports emphasize a role for Nef in viral gene expression and place it in a prime position to oversee and optimize viral replication. Nef may do so by enhancing Tat mediated gene expression from the LTR by activating signalling pathways that result in a concomitant increase in the activation of general transcription factors, and also by mediating translocation of repression factors from the nucleus. Thus, Nef not only enhances infection but also plays an important role in viral replication and pathogenesis.
BACKGROUND: The blood brain barrier (BBB) is the first line of defence of the central nervous system (CNS) against circulating pathogens, such as HIV. The cytotoxic HIV protein, gp120, damages endothelial cells of the BBB, thereby compromising its integrity, which may lead to migration of HIV-infected cells into the brain. Fibroblast growth factor 2 (FGF2), produced primarily by astrocytes, promotes endothelial cell fitness and angiogenesis. We hypothesized that treatment of human umbilical vein endothelial cells (HUVEC) with FGF2 would protect the cells from gp120-mediated toxicity via endothelial cell survival signalling. RESULTS: Exposure of HUVEC to gp120 resulted in dose- and time-dependent cell death; whereas, pre-treatment of endothelial cells with FGF2 protected cells from gp120 angiotoxicity. Treatment of HUVEC with FGF2 resulted in dose- and time-dependent activation of the extracellular regulated kinase (ERK), with moderate effects on phosphoinositol 3 kinase (PI3K) and protein kinase B (PKB), also known as AKT, but no effects on glycogen synthase kinase 3 (GSK3beta) activity. Using pharmacological approaches, gene transfer and kinase activity assays, we show that FGF2-mediated angioprotection against gp120 toxicity is regulated by crosstalk among the ERK, PI3K-AKT and PKC signalling pathways. CONCLUSIONS: Taken together, these results suggest that FGF2 may play a significant role in maintaining the integrity of the BBB during the progress of HIV associated cerebral endothelial cell damage.
Recently, evidence has been accumulating that inositol and phosphatidylinositol polyphosphate play important roles in a variety of signal transduction systems including membrane traffic, actin cytoskeleton rearrangement and cell motility. In this paper, we show for the first time that the SH2-domain-containing inositol 5-phosphatase (SHIP)-2 binds directly to the hepatocyte growth factor (HGF/SF) receptor, c-Met, via phosphotyrosine 1356. HGF induces the breakdown of cell junctions and the dispersion of colonies of epithelial cells including MDCK cells. Whereas only few lamellipodia are observed in MDCK cells 2 min after stimulation with HGF, both SHIP-2- and SHIP-1-overexpressing cells form large, broad lamellipodia. The number of lamellipodia is 2-4-fold greater than that of mock-transfected MDCK cells in the same time period and SHIP is found to colocalize with actin at the leading edge. Furthermore, overexpression of a catalytic inactive mutant of SHIP-2 suppresses HGF-potentiated cell scattering and cell spreading, although these mutant-expressing cells form enhanced number of lamellipodia 2 min after HGF stimulation. Interestingly, cells expressing a mutant lacking the proline-rich domain of SHIP-2 at the C-terminal form few lamellipodia, but still spread and scatter upon stimulation with HGF at a reduced rate. These data suggest that phosphatase activity is required for HGF-mediated cell spreading and scattering but not for alteration of lamellipodium formation, while the proline-rich region influences lamellipodium formation. Furthermore, treatment with 10 microM of phosphatidylinositol 3 (PI3) kinase inhibitor, LY294002, abrogates HGF-induced cell scattering of SHIP-2-overexpressing cells but not parental HEK293 cells, suggesting that a balance between PI3 kinase and SHIP is important for cell motility.
Resource Links
Contents
- Gene Summary
- Orthologs and Paralogs
- Antibodies
- Exon, Intron and UTRs
- CpG near TSS
- Gene Classification
- RefSeq Isoforms
- MicroRNA and Targets
- Transcript Sequences
- Protein Sequences
- Mutations and SNPs
- Phenotypes
- Chemicals and Drugs
- Gene and Diseases
- Gene Interactions
- Transcript Cluster
- Selected Publications

