PIK3R1 | GeneID:5295 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 5295 Official Symbol PIK3R1
Locus N/A Gene Type protein-coding
Synonyms GRB1; p85; p85-ALPHA
Full Name phosphoinositide-3-kinase, regulatory subunit 1 (alpha)
Description phosphoinositide-3-kinase, regulatory subunit 1 (alpha)
Chromosome 5q13.1
Also Known As phosphatidylinositol 3-kinase, regulatory subunit, polypeptide 1 (p85 alpha); phosphatidylinositol 3-kinase, regulatory, 1; phosphatidylinositol 3-kinase-associated p-85 alpha; phosphoinositide-3-kinase, regulatory subunit 1 (p85 alpha); phosphoinositide-3-kinase, regulatory subunit, polypeptide 1 (p85 alpha)
Summary Phosphatidylinositol 3-kinase phosphorylates the inositol ring of phosphatidylinositol at the 3-prime position. The enzyme comprises a 110 kD catalytic subunit and a regulatory subunit of either 85, 55, or 50 kD. This gene encodes the 85 kD regulatory subunit. Phosphatidylinositol 3-kinase plays an important role in the metabolic actions of insulin, and a mutation in this gene has been associated with insulin resistance. Alternative splicing of this gene results in three transcript variants encoding different isoforms. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 7889

ID Symbol Protein Species
GeneID:5295 PIK3R1 NP_852664.1 Homo sapiens
GeneID:18708 Pik3r1 NP_001070963.1 Mus musculus
GeneID:25513 Pik3r1 NP_037137.1 Rattus norvegicus
GeneID:172141 aap-1 NP_491522.1 Caenorhabditis elegans
GeneID:282307 PIK3R1 NP_777000.1 Bos taurus
GeneID:427171 PIK3R1 XP_424759.1 Gallus gallus
GeneID:461836 PIK3R1 XP_517729.2 Pan troglodytes
GeneID:487235 PIK3R1 XP_850341.1 Canis lupus familiaris
GeneID:557176 LOC557176 XP_683819.2 Danio rerio

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab63040 PI 3 Kinase p85 alpha antibody (ab63040); Rabbit polyclonal to PI 3 Kinase p85 alpha
2 abcam ab22653 PI 3 Kinase p85 alpha antibody [Ab6] (ab22653); Mouse monoclonal [Ab6] to PI 3 Kinase p85 alpha
3 abcam ab250 PI 3 Kinase p85 alpha antibody [U13] (ab250); Mouse monoclonal [U13] to PI 3 Kinase p85 alpha
4 abcam ab74136 PI 3 Kinase p85 alpha + Gamma antibody (ab74136); Rabbit polyclonal to PI 3 Kinase p85 alpha + Gamma
5 abcam ab71522 PI 3 Kinase p85 alpha (phospho Y580) antibody (ab71522); Rabbit polyclonal to PI 3 Kinase p85 alpha (phospho Y580)
6 abcam ab65261 PI 3 Kinase p85 alpha (phospho Y368) antibody (ab65261); Rabbit polyclonal to PI 3 Kinase p85 alpha (phospho Y368)
7 abcam ab63566 PI 3 Kinase p85 (SH2) (phospho Y467 + Y199) antibody (ab63566); Rabbit polyclonal to PI 3 Kinase p85 (SH2) (phospho Y467 + Y199)
8 abcam ab61801 PI 3 Kinase p85 alpha (phospho Y607) antibody (ab61801); Rabbit polyclonal to PI 3 Kinase p85 alpha (phospho Y607)
9 abcam ab40755 PI 3 Kinase p85 alpha antibody [ep380y] (ab40755); Rabbit monoclonal [ep380y] to PI 3 Kinase p85 alpha
10 abcam ab33093 PI 3 Kinase p85 (SH2) antibody [0.T.112] (ab33093); Mouse monoclonal [0.T.112] to PI 3 Kinase p85 (SH2)
11 abcam ab31688 PI 3 Kinase p85 (SH2) antibody (ab31688); Rabbit polyclonal to PI 3 Kinase p85 (SH2)
12 abgent AP8023e PIK3R1 Antibody (Y556); Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
13 abgent AP8023f PIK3R1 Antibody (Y580); Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
14 abgent AP8023g PIK3R1 Antibody (Y368); Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
15 abgent AP8023c PIK3R1 Antibody (Y528); Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
16 abgent AP8023d PI3KR1 Antibody (N-term L11); Purified Rabbit Polyclonal Antibody (Pab)
17 abgent AP3580a Phospho-PIK3R1-pY528 Antibody; Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
18 abgent AP3465a Phospho-PIK3R1-Y556 Antibody; Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
19 abgent AP8023a PI3KR1 Antibody (N-term); Purified Rabbit Polyclonal Antibody (Pab)
20 abgent AP3336a Phospho-PIK3R1-Y368 Antibody; Peptide Affinity Purified Rabbit Polyclonal Antibody (Pab)
21 abnova H00005295-M01 PIK3R1 monoclonal antibody (M01), clone 3A10; Mouse monoclonal antibody raised against a full length recombinant PIK3R1.
22 abnova H00005295-M02 PIK3R1 monoclonal antibody (M02), clone 1C10; Mouse monoclonal antibody raised against a full-length recombinant PIK3R1.
23 abnova H00005295-M03 PIK3R1 monoclonal antibody (M03), clone 3C11; Mouse monoclonal antibody raised against a full-length recombinant PIK3R1.
24 acris SM1431P PI-3 Kinase p85 alpha; antibody Ab
25 acris AP14939PU-N PI3KR1 (N-term); antibody Ab
26 acris AP15730PU-N PI3Kp85; antibody Ab
27 acris SM1432 PI-3 Kinase p85 alpha; antibody Ab
28 acris AP12787PU-N PIK3R1 pTyr368; antibody Ab
29 acris AP12990PU-N PIK3R1 pTyr528; antibody Ab
30 acris AP14938PU-N PIK3R1 Y528; antibody Ab
31 acris AP15730PU-S PI3Kp85; antibody Ab
32 acris AP14940PU-N PIK3R1 Y556; antibody Ab
33 acris SM1431 PI-3 Kinase p85 alpha; antibody Ab
34 acris AP00566PU-N PI-3 Kinase p85 alpha; antibody Ab
35 acris AP14941PU-N PIK3R1 Y580; antibody Ab
36 acris AP14942PU-N PIK3R1 Y368; antibody Ab
37 acris AP14937PU-N PI3KR1 (N-term); antibody Ab
38 acris AP08765PU-S PI3KP85 pTyr467; antibody Ab
39 acris AP08765PU-N PI3KP85 pTyr467; antibody Ab
40 acris AP12881PU-N PIK3R1 pTyr556; antibody Ab
41 scbt PIK3R1 PIK3R1 Antibody / PIK3R1 Antibodies;
42 sigma HPA001216 Anti-PIK3R1 antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of PIK3R1 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of PIK3R1 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005943 Component 1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex
GO:0005737 Component cytoplasm
GO:0005829 Component cytosol
GO:0005622 Component intracellular
GO:0016020 Component membrane
GO:0043125 Function ErbB-3 class receptor binding
GO:0043559 Function insulin binding
GO:0005159 Function insulin-like growth factor receptor binding
GO:0005158 Function insulin receptor binding
GO:0043560 Function insulin receptor substrate binding
GO:0005545 Function phosphatidylinositol binding
GO:0035014 Function phosphoinositide 3-kinase regulator activity
GO:0019903 Function protein phosphatase binding
GO:0030183 Process B cell differentiation
GO:0060396 Process growth hormone receptor signaling pathway
GO:0048009 Process insulin-like growth factor receptor signaling pathway
GO:0008286 Process insulin receptor signaling pathway
GO:0044419 Process interspecies interaction between organisms
GO:0043066 Process negative regulation of apoptosis
GO:0001953 Process negative regulation of cell-matrix adhesion
GO:0045671 Process negative regulation of osteoclast differentiation
GO:0014065 Process phosphoinositide 3-kinase cascade
GO:0046854 Process phosphoinositide phosphorylation
GO:0030335 Process positive regulation of cell migration
GO:0046326 Process positive regulation of glucose import
GO:0006468 Process protein amino acid phosphorylation
GO:0070201 Process regulation of establishment of protein localization
GO:0007165 Process signal transduction

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_181504  UCSC Browser NP_852556
2 NM_181523  UCSC Browser NP_852664
3 NM_181524  UCSC Browser NP_852665

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000274335 MI0000475 hsa-miR-136 ACUCCAUUUGUUUUGAUGAUGGA
ENST00000274335 MI0000261 hsa-miR-139-5p UCUACAGUGCACGUGUCUCCAG
ENST00000274335 MI0000115 hsa-miR-16-2* CCAAUAUUACUGUGCUGCUUUA
ENST00000274335 MI0005529 hsa-miR-220b CCACCACCGUGUCUGACACUU
ENST00000274335 MI0003513 hsa-miR-455-5p UAUGUGCCUUUGGACUACAUCG
ENST00000274335 MI0003135 hsa-miR-495 AAACAAACAUGGUGCACUUCUU
ENST00000274335 MI0003136 hsa-miR-496 UGAGUAUUACAUGGCCAAUCUC
ENST00000274335 MI0003579 hsa-miR-572 GUCCGCUCGGCGGUGGCCCA
ENST00000274335 MI0003586 hsa-miR-579 UUCAUUUGGUAUAAACCGCGAUU
ENST00000274335 MI0003602 hsa-miR-590-5p GAGCUUAUUCAUAAAAGUGCAG
ENST00000274335 MI0003644 hsa-miR-630 AGUAUUCUGUACCAGGGAAGGU
ENST00000274335 MI0003763 hsa-miR-767-5p UGCACCAUGGUUGUCUGAGCAUG
ENST00000274335 MI0000389 mmu-miR-291a-5p CAUCAAAGUGGAGGCCCUCUCU
ENST00000274335 MI0003539 mmu-miR-291b-3p AAAGUGCAUCCAUUUUGUUUGU
ENST00000274335 MI0003539 mmu-miR-291b-5p GAUCAAAGUGGAGGCCCUCUCC
ENST00000320694 MI0003513 hsa-miR-455-3p GCAGUCCAUGGGCAUAUACAC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Adenosine Triphosphate
  • Adenosine Triphosphate inhibits the reaction [resveratrol results in decreased activity of [PIK3R1 protein binds to PIK3CA protein]]
17550345
alitretinoin
  • alitretinoin results in increased expression of PIK3R1 mRNA
  • alitretinoin results in increased expression of PIK3R1 protein
16288212
BMS 649
  • [BMS 961 co-treated with BMS 649] results in increased expression of PIK3R1 mRNA
  • [BMS 961 co-treated with BMS 649] results in increased expression of PIK3R1 protein
16288212
BMS 961
  • [BMS 961 co-treated with BMS 649] results in increased expression of PIK3R1 mRNA
  • [BMS 961 co-treated with BMS 649] results in increased expression of PIK3R1 protein
16288212
Deferoxamine
  • PIK3R1 protein does not affect the reaction [Deferoxamine results in increased expression of HIF1A protein]
  • PIK3R1 protein mutant form does not affect the reaction [Deferoxamine results in increased expression of HIF1A protein]
11514583
ferrous sulfate
  • PIK3R1 protein affects the reaction [ferrous sulfate results in increased phosphorylation of AKT1 protein]
  • PIK3R1 protein affects the reaction [ferrous sulfate results in increased phosphorylation of MAPK1 protein]
  • PIK3R1 protein affects the reaction [ferrous sulfate results in increased phosphorylation of MAPK3 protein]
  • PIK3R1 protein affects the reaction [ferrous sulfate results in increased phosphorylation of NFKBIA protein]
  • PIK3R1 protein affects the reaction [ferrous sulfate results in increased secretion of TNF protein]
  • ferrous sulfate does not affect the expression of PIK3R1 protein
  • ferrous sulfate promotes the reaction [MAP3K7 protein binds to HRAS protein binds to PIK3R1 protein]
17172471
Folic Acid
  • Folic Acid affects the expression of PIK3R1 mRNA
16361273
garcinol
  • garcinol results in decreased phosphorylation of and results in decreased activity of PIK3R1 protein
16052481
gedunin
  • gedunin results in decreased expression of PIK3R1 mRNA
17010675
Iron
  • Iron does not affect the expression of PIK3R1 protein
  • Iron promotes the reaction [MAP3K7 protein binds to HRAS protein binds to PIK3R1 protein]
  • PIK3R1 protein affects the reaction [Iron results in increased phosphorylation of AKT1 protein]
  • PIK3R1 protein affects the reaction [Iron results in increased phosphorylation of MAPK1 protein]
  • PIK3R1 protein affects the reaction [Iron results in increased phosphorylation of MAPK3 protein]
  • PIK3R1 protein affects the reaction [Iron results in increased phosphorylation of NFKBIA protein]
  • PIK3R1 protein affects the reaction [Iron results in increased secretion of TNF protein]
17172471
octa-2,4,6-trienoic acid
  • octa-2,4,6-trienoic acid results in decreased expression of PIK3R1 mRNA
16951191
oxophenylarsine
  • PIK3R1 protein does not affect the reaction [oxophenylarsine results in increased expression of HIF1A protein]
  • PIK3R1 protein mutant form does not affect the reaction [oxophenylarsine results in increased expression of HIF1A protein]
11514583
Paraquat
  • Paraquat results in increased expression of PIK3R1 mRNA
12595580
Phenobarbital
  • Phenobarbital results in increased expression of PIK3R1 mRNA
12082028
resveratrol
  • resveratrol inhibits the reaction [INS1 protein promotes the reaction [IRS1 protein binds to PIK3R1 protein]]
16626303
resveratrol
  • Adenosine Triphosphate inhibits the reaction [resveratrol results in decreased activity of [PIK3R1 protein binds to PIK3CA protein]]
  • resveratrol results in decreased activity of [IRS1 protein binds to PIK3R1 protein]
  • resveratrol results in decreased activity of [PIK3R1 protein binds to PIK3CA protein]
  • resveratrol results in decreased activity of [PIK3R1 protein binds to PIK3CB protein]
17550345
resveratrol
  • resveratrol does not affect the expression of PIK3R1 protein
  • resveratrol does not affect the reaction [AR protein binds to PIK3R1 protein]
  • resveratrol does not affect the reaction [ESR1 protein binds to PIK3R1 protein]
17486135
retinol acetate
  • retinol acetate results in increased expression of PIK3R1 mRNA
16772331
Ro 65-7199
  • Ro 65-7199 results in decreased expression of PIK3R1 mRNA
14610520
Ro 66-0074
  • Ro 66-0074 affects the expression of PIK3R1 mRNA
14610520
S-Nitrosoglutathione
  • PIK3R1 protein does not affect the reaction [S-Nitrosoglutathione results in increased expression of HIF1A protein]
  • PIK3R1 protein mutant form inhibits the reaction [S-Nitrosoglutathione results in increased expression of HIF1A protein]
11514583
tert-Butylhydroperoxide
  • tert-Butylhydroperoxide results in decreased expression of PIK3R1 mRNA
15336504
Tretinoin
  • PIK3R1 protein promotes the reaction [Tretinoin results in increased activity of AKT1 protein]
  • Tretinoin results in increased expression of PIK3R1 mRNA
  • Tretinoin results in increased expression of PIK3R1 protein
16288212
tripterine
  • tripterine results in decreased expression of PIK3R1 mRNA
17010675
Tunicamycin
  • Tunicamycin results in decreased expression of PIK3R1 mRNA
17127020
Uranium
  • Uranium affects the expression of PIK3R1 mRNA
15672453
uranyl acetate
  • uranyl acetate affects the expression of PIK3R1 mRNA
15672453

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Alopecia inferred via Tretinoin 15955085
Arthritis, Experimental inferred via Tretinoin 16412693
Arthritis, Rheumatoid inferred via Tretinoin 16292516
Asthma inferred via Tretinoin 16456186
Barrett Esophagus inferred via Tretinoin 16935849
Blood Coagulation Disorders inferred via Tretinoin 16197459, 16206674
Breast Neoplasms inferred via Tretinoin 16873071, 16166294, 16443354
Bronchopulmonary Dysplasia inferred via Tretinoin 16813970
Carcinoma, Embryonal inferred via Tretinoin 16168501
Carcinoma, Squamous Cell inferred via Tretinoin 16096774, 16051514
Cataract inferred via Tretinoin 17460283
Cervical Intraepithelial Neoplasia inferred via Tretinoin 16129372
Choriocarcinoma inferred via Tretinoin 16461808
Colitis inferred via Tretinoin 17035595
Craniofacial Abnormalities inferred via Tretinoin 16925845
Endometrial Neoplasms inferred via Tretinoin 16569247
Eye Abnormalities inferred via Tretinoin 16938888
Glioblastoma inferred via Tretinoin 17312396
Head and Neck Neoplasms inferred via Tretinoin 16096774
Hearing Loss, Noise-Induced inferred via Tretinoin 16084493
Hyperalgesia inferred via Tretinoin 16870215
Hypereosinophilic Syndrome inferred via Tretinoin 16778211
Leukemia inferred via Tretinoin 17143497
Leukemia, Myeloid inferred via Tretinoin 16932348, 16482212
Leukemia, Myeloid, Acute inferred via Tretinoin 16294345
Leukemia, Promyelocytic, Acute inferred via Tretinoin 16891316, 16788101, 16766008, 17294898, 17361223, 17368321, 17301526, 17339181, 17506722, 17217047, 17107899, 16140955, 16331271, 16935935, 16823087, 12679006, 15748426
Liver Cirrhosis, Experimental inferred via Tretinoin 16248980, 18397230
Medulloblastoma inferred via Tretinoin 17453147
Melanoma inferred via Tretinoin 16752155
Meningomyelocele inferred via Tretinoin 16940565
Neoplasms inferred via Tretinoin 16946489, 16594593
Ovarian Neoplasms inferred via Tretinoin 16936753
Pain inferred via Tretinoin 16870215
Pancreatic Neoplasms inferred via Tretinoin 15976015
Pterygium inferred via Tretinoin 16723453
Rhabdomyosarcoma inferred via Tretinoin 16116481, 16283617
Skin Neoplasms inferred via Tretinoin 16467112
Stomach Neoplasms inferred via Tretinoin 17261132
Thyroid Neoplasms inferred via Tretinoin 17045167, 16026305
Tongue Neoplasms inferred via Tretinoin 16051514
Tuberculosis inferred via Tretinoin 16040207
Uterine Cervical Neoplasms inferred via Tretinoin 16129372
Uveal Neoplasms inferred via Tretinoin 16752155
Vitiligo inferred via Tretinoin 16761959
Wilms Tumor inferred via Tretinoin 16287080
Adenoma inferred via resveratrol 15688382
Alzheimer Disease inferred via resveratrol 16183991, 16162502
Arthritis, Experimental inferred via resveratrol 17115116
Atherosclerosis inferred via resveratrol 16873680, 17967414
Brain Ischemia inferred via resveratrol 17600658
Breast Neoplasms inferred via resveratrol 17651959, 17534123, 16393696
Carcinoma, Hepatocellular inferred via resveratrol 16227395
Carcinoma, Lewis Lung inferred via resveratrol 16675471
Carcinoma, Squamous Cell inferred via resveratrol 16227395
Cardiovascular Diseases inferred via resveratrol 15458977
Colitis inferred via resveratrol 16474422
Colonic Neoplasms inferred via resveratrol 16338953
Colorectal Neoplasms inferred via resveratrol 16550006
Diabetes Mellitus, Experimental inferred via resveratrol 16873680
Diabetic Nephropathies inferred via resveratrol 16286809
Edema inferred via resveratrol 8985016
Encephalomyelitis, Autoimmune, Experimental inferred via resveratrol 17872969
Enterocolitis, Necrotizing inferred via resveratrol 17923197
Herpes Simplex inferred via resveratrol 16876885
Hypercholesterolemia inferred via resveratrol 17188708
Hyperlipidemias inferred via resveratrol 16873680
Hypertrophy, Left Ventricular inferred via resveratrol 17488730
Infarction, Middle Cerebral Artery inferred via resveratrol 17600658
Inflammation inferred via resveratrol 16366677
Influenza, Human inferred via resveratrol 16624496
Kidney Failure, Acute inferred via resveratrol 16538975
Leukemia, Promyelocytic, Acute inferred via resveratrol 16087638
Lymphoma, B-Cell inferred via resveratrol 17088997
Lymphoma, Non-Hodgkin inferred via resveratrol 14749477
Mammary Neoplasms, Animal inferred via resveratrol 15688416
Mammary Neoplasms, Experimental inferred via resveratrol 8985016, 11606380
Melanoma inferred via resveratrol 17992120
Metabolic Diseases inferred via resveratrol 17112576
Multiple Myeloma inferred via resveratrol 14749477, 17164350, 17935668, 17049120, 16267019, 16490592
Muscular Atrophy, Spinal inferred via resveratrol 17962980
Myocardial Infarction inferred via resveratrol 17188708, 17125593, 17015251, 16456233, 16317513, 16525036
Myocardial Ischemia inferred via resveratrol 17125593, 17015251
Myocarditis inferred via resveratrol 17322642
Neoplasms, Experimental inferred via resveratrol 8985016
Neurodegenerative Diseases inferred via resveratrol 17652729
Neurogenic Inflammation inferred via resveratrol 17929310
Osteoporosis, Postmenopausal inferred via resveratrol 17513867
Prenatal Exposure Delayed Effects inferred via resveratrol 16679765
Prostatic Neoplasms inferred via resveratrol 17675339, 16731767, 17718901, 17636462, 17804756, 15767336
Renal Insufficiency, Chronic inferred via resveratrol 16325855
Reperfusion Injury inferred via resveratrol 17058453, 16317513, 17520802, 16314181, 15827377
Skin Neoplasms inferred via resveratrol 15837718, 8985016
STROKE, ISCHEMIC inferred via resveratrol 16321402
Tongue Neoplasms inferred via resveratrol 16227395
Uterine Cervical Neoplasms inferred via resveratrol 17473185
Uterine Neoplasms inferred via resveratrol 17044934
Ventricular Dysfunction, Left inferred via resveratrol 17488730
Dystonia inferred via Phenobarbital 1851702
Epilepsy, Absence inferred via Phenobarbital 6401628
Liver Neoplasms inferred via Phenobarbital 15975961, 8742319
Myoclonic Epilepsies, Progressive inferred via Phenobarbital 17484760
Osteomalacia inferred via Phenobarbital 17016548
Pancreatic Neoplasms inferred via Phenobarbital 16965848
Pseudolymphoma inferred via Phenobarbital 12752131
Seizures, Febrile inferred via Phenobarbital 6407741
Agricultural Workers' Diseases inferred via Paraquat 11874814
Gliosis inferred via Paraquat 11124998
Nerve Degeneration inferred via Paraquat 16893418
Parkinson Disease inferred via Paraquat 12911755, 11181820, 15824117, 16140633, 15451049, 16510128, 11124998, 11445065
Pneumonia inferred via Paraquat 12504350
Pulmonary Fibrosis inferred via Paraquat 16324872, 17997886
Respiratory Distress Syndrome, Adult inferred via Paraquat 11700416
Respiratory Sounds inferred via Paraquat 11874814
Retinal Degeneration inferred via Paraquat 16458197
alpha 1-Antitrypsin Deficiency inferred via Iron 16640825
Alzheimer Disease inferred via Iron 16640825, 16563566
Anemia inferred via Iron 16566752, 16434484
Anemia, Iron-Deficiency inferred via Iron 17162259, 17375513, 17147795, 16569441, 17163184
Anemia, Sideroblastic inferred via Iron 16910769
Arrhythmias, Cardiac inferred via Iron 16604332
Atherosclerosis inferred via Iron 16640825, 16632123
Bacterial Infections inferred via Iron 16640825
Cardiomyopathies inferred via Iron 16640825
Cardiomyopathy, Dilated inferred via Iron 16604332
Colonic Neoplasms inferred via Iron 16640825
Diabetes Mellitus inferred via Iron 16640825, 16604332
Diabetes Mellitus, Type 1 inferred via Iron 16506275
Diabetes Mellitus, Type 2 inferred via Iron 16506275
Fatty Liver inferred via Iron 16640825
Friedreich Ataxia inferred via Iron 16640825, 16604332
Hemochromatosis inferred via Iron 17236123, 17053826, 16640825, 16604332, 16574947, 17255318
Hemosiderosis inferred via Iron 16604332
Hepatitis, Viral, Human inferred via Iron 16640825
Hepatolenticular Degeneration inferred via Iron 17182432
Hepatomegaly inferred via Iron 16890145
HIV Infections inferred via Iron 16597321
Hypogonadism inferred via Iron 16640825
Hypothyroidism inferred via Iron 16640825
Iron Metabolism Disorders inferred via Iron 17163184
Lewy Body Disease inferred via Iron 16563566
Liver Cirrhosis inferred via Iron 16640825
Liver Diseases, Alcoholic inferred via Iron 17207112, 16737972
Liver Neoplasms inferred via Iron 16640825
Lung Neoplasms inferred via Iron 16640825
Macular Degeneration inferred via Iron 16640825
Multiple Sclerosis, Chronic Progressive inferred via Iron 17086897
Mycoses inferred via Iron 16640825
Myocardial Ischemia inferred via Iron 16604332
Myocardial Reperfusion Injury inferred via Iron 16604332
Nephrotic Syndrome inferred via Iron 17178036
Neurodegenerative Diseases inferred via Iron 17296847, 16604332
Osteoarthritis inferred via Iron 16640825
Osteoporosis inferred via Iron 16640825, 16648989
Parkinson Disease inferred via Iron 16640825, 16563566
Pituitary Diseases inferred via Iron 16604332
Poisoning inferred via Iron 16604332
Porphyria Cutanea Tarda inferred via Iron 16640825
Pre-Eclampsia inferred via Iron 16640825
Protozoan Infections inferred via Iron 16640825
Restless Legs Syndrome inferred via Iron 16930377
Sudden Infant Death inferred via Iron 16640825
Tuberculosis inferred via Iron 16597321
Adenoma inferred via Folic Acid 16963246
Alzheimer Disease inferred via Folic Acid 17116317
Breast Neoplasms inferred via Folic Acid 16777985
Cardiovascular Diseases inferred via Folic Acid 16755160
Colorectal Neoplasms inferred via Folic Acid 16963246, 16985020, 17087956, 17245555, 17116713
Diabetes Mellitus, Type 2 inferred via Folic Acid 16886840
Endometrial Neoplasms inferred via Folic Acid 17301261
Exfoliation Syndrome inferred via Folic Acid 16504073
Gastritis inferred via Folic Acid 17171786
Glaucoma inferred via Folic Acid 16504073
Heart Defects, Congenital inferred via Folic Acid 17286298, 16524890
HIV Seropositivity inferred via Folic Acid 17209195
Hyperhomocysteinemia inferred via Folic Acid 16397167, 16395265, 16865747, 16433478, 16755160
Liver Diseases inferred via Folic Acid 16877991
Lupus Erythematosus, Systemic inferred via Folic Acid 17718048
Maxillofacial Abnormalities inferred via Folic Acid 16832597
Neural Tube Defects inferred via Folic Acid 17438019
Neutropenia inferred via Folic Acid 16322990
Schizophrenia inferred via Folic Acid 16641680
Spinal Cord Diseases inferred via Folic Acid 16361298
Stomach Neoplasms inferred via Folic Acid 17171786
Stroke inferred via Folic Acid 16517955
Breast Neoplasms inferred via Deferoxamine 15993339
Breast Neoplasms inferred via alitretinoin 16344269
Keratosis, Seborrheic inferred via alitretinoin 16144296
Lung Neoplasms inferred via alitretinoin 16413115
Neoplasms inferred via alitretinoin 16946489
Porokeratosis inferred via alitretinoin 16144296

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
ABL1 ABL1 / PIK3R1 Reconstituted Complex Kapeller R (1994)
ADAM12 ADAM12 / PIK3R1 Affinity Capture-Western Kang Q (2001)
ADAM12 PIK3R1 / ADAM12 Affinity Capture-Western Kang Q (2001)
ADAM12 PIK3R1 / ADAM12 Reconstituted Complex Kang Q (2001)
ARAF ARAF / PIK3R1 Reconstituted Complex Fang Y (2002)
ARHGAP1 PIK3R1 / ARHGAP1 Reconstituted Complex Barfod ET (1993)
ARHGAP17 ARHGAP17 / PIK3R1 Reconstituted Complex Richnau N (2001)
AXL AXL / PIK3R1 Biochemical Activity Braunger J (1997)
BCAR1 BCAR1 / PIK3R1 Affinity Capture-Western Li E (2000)
BCAR1 PIK3R1 / BCAR1 Reconstituted Complex Li E (2000)
CBL CBL / PIK3R1 Affinity Capture-Western Gesbert F (1998)
CBL PIK3R1 / CBL Affinity Capture-Western Gesbert F (1998)
CBL CBL / PIK3R1 Affinity Capture-Western Zhang S (1999)
CBLB CBLB / PIK3R1 Affinity Capture-Western Lavagna-Sevenier C (1998)
CD28 CD28 / PIK3R1 Affinity Capture-Western Pages F (1996)
CD28 PIK3R1 / CD28 Protein-peptide Pages F (1996)
CD3E CD3E / PIK3R1 Affinity Capture-Western de Aos I (1997)
CD5 PIK3R1 / CD5 Invivo Dennehy KM (1997)
CD7 CD7 / PIK3R1 Affinity Capture-Western Subrahmanyam G (2003)
CD7 PIK3R1 / CD7 Reconstituted Complex Lee DM (1996)
CDC42 PIK3R1 / CDC42 Invitro Carpenter CL (1997)
CDC42 PIK3R1 / CDC42 Invivo Carpenter CL (1997)
CENTG1 PIK3R1 / CENTG1 Affinity Capture-Western Ye K (2000)
CENTG1 CENTG1 / PIK3R1 Reconstituted Complex Ye K (2000)
CRKL CRKL / PIK3R1 Affinity Capture-Western Gesbert F (1998)
CSF1R PIK3R1 / CSF1R Affinity Capture-Western Kanagasundaram V (1996)
CSF2RA CSF2RA / PIK3R1 Affinity Capture-Western Dhar-Mascareno M (2003)
Ctnnb1 PIK3R1 / Ctnnb1 Affinity Capture-Western Espada J (1999)
CTNNB1 CTNNB1 / PIK3R1 Reconstituted Complex Espada J (1999)
DOK1 DOK1 / PIK3R1 Reconstituted Complex van Dijk TB (2000)
EPHA2 PIK3R1 / EPHA2 Affinity Capture-Western Pandey A (1994)
EPHA2 PIK3R1 / EPHA2 Reconstituted Complex Pandey A (1994)
EPHA2 PIK3R1 / EPHA2 Two-hybrid Pandey A (1994)
EPOR EPOR / PIK3R1 Affinity Capture-Western Damen JE (1995)
EPOR EPOR / PIK3R1 Affinity Capture-Western Shigematsu H (1997)
EPOR PIK3R1 / EPOR Affinity Capture-Western Shigematsu H (1997)
EPOR PIK3R1 / EPOR Reconstituted Complex Damen JE (1995)
ERBB3 ERBB3 / PIK3R1 Affinity Capture-Western Hellyer NJ (2001)
ERBB3 PIK3R1 / ERBB3 Affinity Capture-Western Lin J (1999)
ESR1 ESR1 / PIK3R1 Affinity Capture-Western Castoria G (2001)
FCGR2A FCGR2A / PIK3R1 Affinity Capture-Western Chacko GW (1996)
FCGR2A FCGR2A / PIK3R1 Reconstituted Complex Ibarrola I (1997)
FES PIK3R1 / FES Affinity Capture-Western Izuhara K (1996)
FYN FYN / PIK3R1 Reconstituted Complex Kapeller R (1994)
GAB1 GAB1 / PIK3R1 Affinity Capture-Western Holgado-Madruga M (1996)
GAB1 GAB1 / PIK3R1 Far Western Holgado-Madruga M (1996)
GAB1 PIK3R1 / GAB1 Reconstituted Complex Bertagnolo V (1998)
Gab2 Gab2 / PIK3R1 Affinity Capture-Western Liu Y (2001)
Gab2 PIK3R1 / Gab2 Affinity Capture-Western Liu Y (2001)
GAB2 GAB2 / PIK3R1 Affinity Capture-Western Crouin C (2001)
GAB2 GAB2 / PIK3R1 Affinity Capture-Western Lynch DK (2002)
GAB2 GAB2 / PIK3R1 Two-hybrid Crouin C (2001)
GHR PIK3R1 / GHR Reconstituted Complex Moutoussamy S (1998)
GNAQ GNAQ / PIK3R1 Affinity Capture-Western Ballou LM (2003)
GRB2 GRB2 / PIK3R1 Affinity Capture-Western Saleem A (1995)
GRB2 GRB2 / PIK3R1 Affinity Capture-Western Wang J (1995)
GRB2 GRB2 / PIK3R1 Reconstituted Complex Saleem A (1995)
GRB2 GRB2 / PIK3R1 Reconstituted Complex Wang J (1995)
GRB2 PIK3R1 / GRB2 Two-hybrid Wang J (1995)
HCST PIK3R1 / HCST Protein-peptide Wu J (1999)
HRAS PIK3R1 / HRAS Affinity Capture-Western Hanna AN (1999)
HRAS PIK3R1 / HRAS Reconstituted Complex Rodriguez-Viciana P (1997)
IFNAR1 IFNAR1 / PIK3R1 Affinity Capture-Western Rani MR (1999)
IGF1R PIK3R1 / IGF1R Invitro Benito M (1996)
IL1R1 IL1R1 / PIK3R1 Affinity Capture-Western Reddy SA (1997)
IL1R1 PIK3R1 / IL1R1 Affinity Capture-Western Reddy SA (1997)
IL1R1 IL1R1 / PIK3R1 Invitro Sizemore N (1999)
IL1RAP IL1RAP / PIK3R1 Invitro Sizemore N (1999)
IL1RAP IL1RAP / PIK3R1 Invivo Sizemore N (1999)
IL2RB IL2RB / PIK3R1 Invitro Migone TS (1998)
IL2RB IL2RB / PIK3R1 Invivo Migone TS (1998)
IL6ST IL6ST / PIK3R1 Affinity Capture-Western Chung TD (2000)
INPP5D PIK3R1 / INPP5D Affinity Capture-Western Zhang S (1999)
IRS1 IRS1 / PIK3R1 Affinity Capture-Western Gual P (2003)
IRS1 PIK3R1 / IRS1 Affinity Capture-Western Hadari YR (1992)
IRS1 IRS1 / PIK3R1 Affinity Capture-Western Morrison KB (2002)
IRS1 IRS1 / PIK3R1 Far Western Hamer I (2002)
IRS2 IRS2 / PIK3R1 Affinity Capture-Western Argetsinger LS (1996)
IRS2 IRS2 / PIK3R1 Affinity Capture-Western Kim B (1998)
IRS2 IRS2 / PIK3R1 Affinity Capture-Western Verdier F (1997)
IRS2 IRS2 / PIK3R1 Far Western Hamer I (2002)
JAK1 JAK1 / PIK3R1 Invivo Migone TS (1998)
JAK2 JAK2 / PIK3R1 Affinity Capture-Western Fuhrer DK (1996)
JAK2 PIK3R1 / JAK2 Affinity Capture-Western Fuhrer DK (1996)
K-ALPHA-1 PIK3R1 / K-ALPHA-1 Affinity Capture-Western Kapeller R (1995)
K-ALPHA-1 PIK3R1 / K-ALPHA-1 Reconstituted Complex Kapeller R (1995)
KHDRBS1 PIK3R1 / KHDRBS1 Affinity Capture-Western Sanchez-Margalet V (2001)
KHDRBS1 KHDRBS1 / PIK3R1 Affinity Capture-Western Shen Z (1999)
KHDRBS1 KHDRBS1 / PIK3R1 Reconstituted Complex Shen Z (1999)
KIT KIT / PIK3R1 Affinity Capture-Western Serve H (1994)
KIT KIT / PIK3R1 Reconstituted Complex van Dijk TB (2000)
KIT KIT / PIK3R1 Two-hybrid De Sepulveda P (1999)
LAT LAT / PIK3R1 Affinity Capture-Western Paz PE (2001)
LAT LAT / PIK3R1 Reconstituted Complex Paz PE (2001)
LCK LCK / PIK3R1 Reconstituted Complex Kapeller R (1994)
LCP2 LCP2 / PIK3R1 Affinity Capture-Western Shim EK (2004)
LCP2 LCP2 / PIK3R1 Two-hybrid Shim EK (2004)
NFKBIA PIK3R1 / NFKBIA Reconstituted Complex Beraud C (1999)
NTRK2 NTRK2 / PIK3R1 Two-hybrid Suzuki S (2002)
PDGFRB PDGFRB / PIK3R1 Invivo Farooqui T ()
PECAM1 PECAM1 / PIK3R1 Affinity Capture-Western Pellegatta F (1998)
PIK3AP1 PIK3R1 / PIK3AP1 Affinity Capture-Western Okada T (2000)
PIK3CA PIK3R1 / PIK3CA Reconstituted Complex Woscholski R (1994)
PIK3CB PIK3CB / PIK3R1 Affinity Capture-Western Hu P (1994)
PIK3CD PIK3CD / PIK3R1 Affinity Capture-Western Vanhaesebroeck B (1997)
PIK3CD PIK3CD / PIK3R1 Reconstituted Complex Vanhaesebroeck B (1997)
PIK3R1 PIK3R1 / PIK3R1 Reconstituted Complex Kapeller R (1994)
PTK2 PTK2 / PIK3R1 Affinity Capture-Western Guinebault C (1995)
PTK2 PTK2 / PIK3R1 Far Western Guinebault C (1995)
PTPN11 PIK3R1 / PTPN11 Affinity Capture-Western Zhang S (1999)
PTPN6 PTPN6 / PIK3R1 Two-hybrid Sathish JG (2001)
PXN PIK3R1 / PXN Co-purification Salgia R (1996)
RICS RICS / PIK3R1 Affinity Capture-Western Moon SY (2003)
RRAS2 PIK3R1 / RRAS2 Affinity Capture-Western Rong R (2002)
SH3KBP1 PIK3R1 / SH3KBP1 Reconstituted Complex Gout I (2000)
SHB SHB / PIK3R1 Affinity Capture-Western Karlsson T (1995)
SHB SHB / PIK3R1 Reconstituted Complex Karlsson T (1995)
SHC1 SHC1 / PIK3R1 Reconstituted Complex Harrison-Findik D (1995)
SRC SRC / PIK3R1 Affinity Capture-Western Burnham MR (1999)
SYN1 SYN1 / PIK3R1 Invivo Onofri F (2000)
TGFBR1 TGFBR1 / PIK3R1 Affinity Capture-Western Krymskaya VP (1997)
TGFBR2 TGFBR2 / PIK3R1 Affinity Capture-Western Krymskaya VP (1997)
Thra Thra / PIK3R1 Affinity Capture-Western Kenessey A (2006)
TLN1 PIK3R1 / TLN1 Co-purification Salgia R (1996)
TYRO3 TYRO3 / PIK3R1 Affinity Capture-Western Lan Z (2000)
TYRO3 TYRO3 / PIK3R1 Two-hybrid Lan Z (2000)
VAV1 PIK3R1 / VAV1 Affinity Capture-Western Bertagnolo V (1998)
VAV1 VAV1 / PIK3R1 Affinity Capture-Western Bertagnolo V (1998)
VAV1 PIK3R1 / VAV1 Affinity Capture-Western Shigematsu H (1997)
VAV1 VAV1 / PIK3R1 Affinity Capture-Western Shigematsu H (1997)
VAV1 PIK3R1 / VAV1 Reconstituted Complex Bertagnolo V (1998)
VAV1 PIK3R1 / VAV1 Reconstituted Complex Shigematsu H (1997)
VIL2 PIK3R1 / VIL2 Affinity Capture-Western Gautreau A (1999)
VIL2 VIL2 / PIK3R1 Reconstituted Complex Gautreau A (1999)
WAS PIK3R1 / WAS Affinity Capture-Western Banin S (1996)
WAS PIK3R1 / WAS Reconstituted Complex Banin S (1996)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Ruano G, et al. (2009) "Physiogenomic comparison of edema and BMI in patients receiving rosiglitazone or pioglitazone." Clin Chim Acta. 400(1-2):48-55. PMID:18996102
  2. [ + ] Kim JJ, et al. (2009) "Phosphatidylinositol 3-kinase p85alpha regulatory subunit gene Met326Ile polymorphism in women with polycystic ovary syndrome." Hum Reprod. 24(5):1184-1190. PMID:19218574
  3. [ + ] Sulahian R, et al. (2009) "Ligand-induced EpoR internalization is mediated by JAK2 and p85 and is impaired by mutations responsible for primary familial and congenital polycythemia." Blood. 113(21):5287-5297. PMID:19336760
  4. [ + ] Blackford A, et al. (2009) "Genetic mutations associated with cigarette smoking in pancreatic cancer." Cancer Res. 69(8):3681-3688. PMID:19351817
  5. [ + ] Segovis CM, et al. (2009) "PI3K links NKG2D signaling to a CrkL pathway involved in natural killer cell adhesion, polarity, and granule secretion." J Immunol. 182(11):6933-6942. PMID:19454690
  6. [ + ] Wu TT, et al. (2008) "Reduction of PKC alpha decreases cell proliferation, migration, and invasion of human malignant hepatocellular carcinoma." J Cell Biochem. 103(1):9-20. PMID:17486587
  7. [ + ] Barbe L, et al. (2008) "Toward a confocal subcellular atlas of the human proteome." Mol Cell Proteomics. 7(3):499-508. PMID:18029348
  8. [ + ] Guiducci C, et al. (2008) "PI3K is critical for the nuclear translocation of IRF-7 and type I IFN production by human plasmacytoid predendritic cells in response to TLR activation." J Exp Med. 205(2):315-322. PMID:18227218
  9. [ + ] Li L, et al. (2008) "Association between phosphatidylinositol 3-kinase regulatory subunit p85alpha Met326Ile genetic polymorphism and colon cancer risk." Clin Cancer Res. 14(3):633-637. PMID:18245521
  10. [ + ] Jones MR, et al. (2008) "Polymorphism in postinsulin receptor signaling pathway is not associated with polycystic ovary syndrome." Fertil Steril. 90(6):2298-2303. PMID:18249389
  11. [ + ] Kleber S, et al. (2008) "Yes and PI3K bind CD95 to signal invasion of glioblastoma." Cancer Cell. 13(3):235-248. PMID:18328427
  12. [ + ] Desrivieres S, et al. (2008) "Nucleotide sequence variation within the PI3K p85 alpha gene associates with alcohol risk drinking behaviour in adolescents." PLoS ONE. 3(3):e1769. PMID:18335044
  13. [ + ] Zhu Q, et al. (2008) "Phosphoinositide 3-OH kinase p85alpha and p110beta are essential for androgen receptor transactivation and tumor progression in prostate cancers." Oncogene. 27(33):4569-4579. PMID:18372911
  14. [ + ] Dufour C, et al. (2008) "FGFR2-Cbl interaction in lipid rafts triggers attenuation of PI3K/Akt signaling and osteoblast survival." Bone. 42(6):1032-1039. PMID:18374639
  15. [ + ] Huang CH, et al. (2008) "Insights into the oncogenic effects of PIK3CA mutations from the structure of p110alpha/p85alpha." Cell Cycle. 7(9):1151-1156. PMID:18418043
  16. [ + ] Li Y, et al. (2008) "Mechanism of influenza A virus NS1 protein interaction with the p85beta, but not the p85alpha, subunit of phosphatidylinositol 3-kinase (PI3K) and up-regulation of PI3K activity." J Biol Chem. 283(34):23397-23409. PMID:18534979
  17. [ + ] Lu Y, et al. (2008) "Multiple genetic variants along candidate pathways influence plasma high-density lipoprotein cholesterol concentrations." J Lipid Res. 49(12):2582-2589. PMID:18660489
  18. [ + ] Torres VA, et al. (2008) "Caspase 8 promotes peripheral localization and activation of Rab5." J Biol Chem. 283(52):36280-36289. PMID:18974049
  19. [ + ] Boulay PL, et al. (2008) "ADP-ribosylation factor 1 controls the activation of the phosphatidylinositol 3-kinase pathway to regulate epidermal growth factor-dependent growth and migration of breast cancer cells." J Biol Chem. 283(52):36425-36434. PMID:18990689
  20. [ + ] Tokunaga E, et al. (2007) "Coexistence of the loss of heterozygosity at the PTEN locus and HER2 overexpression enhances the Akt activity thus leading to a negative progesterone receptor expression in breast carcinoma." Breast Cancer Res Treat. 101(3):249-257. PMID:17006756
  21. [ + ] Harir N, et al. (2007) "Constitutive activation of Stat5 promotes its cytoplasmic localization and association with PI3-kinase in myeloid leukemias." Blood. 109(4):1678-1686. PMID:17038539
  22. [ + ] Chugh P, et al. (2007) "Infection of human immunodeficiency virus and intracellular viral Tat protein exert a pro-survival effect in a human microglial cell line." J Mol Biol. 366(1):67-81. PMID:17157319
  23. [ + ] Jamshidi Y, et al. (2007) "SHP-2 and PI3-kinase genes PTPN11 and PIK3R1 may influence serum apoB and LDL cholesterol levels in normal women." Atherosclerosis. 194(2):e26-e33. PMID:17214991
  24. [ + ] Badour K, et al. (2007) "Interaction of the Wiskott-Aldrich syndrome protein with sorting nexin 9 is required for CD28 endocytosis and cosignaling in T cells." Proc Natl Acad Sci U S A. 104(5):1593-1598. PMID:17242350
  25. [ + ] Xie Z, et al. (2007) "The recruitment of phosphatidylinositol 3-kinase to the E-cadherin-catenin complex at the plasma membrane is required for calcium-induced phospholipase C-gamma1 activation and human keratinocyte differentiation." J Biol Chem. 282(12):8695-8703. PMID:17242406
  26. [ + ] Singh RS, et al. (2007) "Phosphoinositide 3-kinase is not overexpressed in melanocytic lesions." J Cutan Pathol. 34(3):220-225. PMID:17302605
  27. [ + ] Yu X, et al. (2007) "Regulation of scavenger receptor class BI gene expression by angiotensin II in vascular endothelial cells." Hypertension. 49(6):1378-1384. PMID:17404186
  28. [ + ] Kamen LA, et al. (2007) "Differential association of phosphatidylinositol 3-kinase, SHIP-1, and PTEN with forming phagosomes." Mol Biol Cell. 18(7):2463-2472. PMID:17442886
  29. [ + ] Yamaki N, et al. (2007) "RhoG regulates anoikis through a phosphatidylinositol 3-kinase-dependent mechanism." Exp Cell Res. 313(13):2821-2832. PMID:17570359
  30. [ + ] Hers I, et al. (2007) "Insulin-like growth factor-1 potentiates platelet activation via the IRS/PI3Kalpha pathway." Blood. 110(13):4243-4252. PMID:17827393
  31. [ + ] Nakhaei-Nejad M, et al. (2007) "Endothelial PI 3-kinase activity regulates lymphocyte diapedesis." Am J Physiol Heart Circ Physiol. 293(6):H3608-H3616. PMID:17890432
  32. [ + ] Huang CH, et al. (2007) "The structure of a human p110alpha/p85alpha complex elucidates the effects of oncogenic PI3Kalpha mutations." Science. 318(5857):1744-1748. PMID:18079394
  33. [ + ] Lottin-Divoux S, et al. (2006) "Activation of Epstein-Barr virus/C3d receptor (gp140, CR2, CD21) on human B lymphoma cell surface triggers Cbl tyrosine phosphorylation, its association with p85 subunit, Crk-L and Syk and its dissociation with Vav." Cell Signal. 18(8):1219-1225. PMID:16289966
  34. [ + ] Kwon M, et al. (2006) "Recruitment of the tyrosine phosphatase Src homology 2 domain tyrosine phosphatase-2 to the p85 subunit of phosphatidylinositol-3 (PI-3) kinase is required for insulin-like growth factor-I-dependent PI-3 kinase activation in smooth muscle cells." Endocrinology. 147(3):1458-1465. PMID:16306077
  35. [ + ] Ignatiuk A, et al. (2006) "The smaller isoforms of ankyrin 3 bind to the p85 subunit of phosphatidylinositol 3'-kinase and enhance platelet-derived growth factor receptor down-regulation." J Biol Chem. 281(9):5956-5964. PMID:16377635
  36. [ + ] Qiao J, et al. (2006) "Inhibition of transforming growth factor-beta/Smad signaling by phosphatidylinositol 3-kinase pathway." Cancer Lett. 242(2):207-214. PMID:16412560
  37. [ + ] Cornier MA, et al. (2006) "Nutritional upregulation of p85alpha expression is an early molecular manifestation of insulin resistance." Diabetologia. 49(4):748-754. PMID:16491394
  38. [ + ] Anand AR, et al. (2006) "HIV-1 gp120-mediated apoptosis of T cells is regulated by the membrane tyrosine phosphatase CD45." J Biol Chem. 281(18):12289-12299. PMID:16524887
  39. [ + ] Rhee SH, et al. (2006) "Role of MyD88 in phosphatidylinositol 3-kinase activation by flagellin/toll-like receptor 5 engagement in colonic epithelial cells." J Biol Chem. 281(27):18560-18568. PMID:16644730
  40. [ + ] Kenessey A, et al. (2006) "Thyroid hormone stimulates protein synthesis in the cardiomyocyte by activating the Akt-mTOR and p70S6K pathways." J Biol Chem. 281(30):20666-20672. PMID:16717100
  41. [ + ] Dance M, et al. (2006) "The adaptor protein Gab1 couples the stimulation of vascular endothelial growth factor receptor-2 to the activation of phosphoinositide 3-kinase." J Biol Chem. 281(32):23285-23295. PMID:16787925
  42. [ + ] Koga F, et al. (2006) "Hsp90 inhibition transiently activates Src kinase and promotes Src-dependent Akt and Erk activation." Proc Natl Acad Sci U S A. 103(30):11318-11322. PMID:16844778
  43. [ + ] Huang ZY, et al. (2006) "Differential kinase requirements in human and mouse Fc-gamma receptor phagocytosis and endocytosis." J Leukoc Biol. 80(6):1553-1562. PMID:16921024
  44. [ + ] Lee J, et al. (2006) "Autotaxin stimulates urokinase-type plasminogen activator expression through phosphoinositide 3-kinase-Akt-nuclear [corrected] factor kappa B signaling cascade in human melanoma cells." Melanoma Res. 16(5):445-452. PMID:17013094
  45. [ + ] Jamshidi Y, et al. (2006) "Phosphatidylinositol 3-kinase p85alpha regulatory subunit gene PIK3R1 haplotype is associated with body fat and serum leptin in a female twin population." Diabetologia. 49(11):2659-2667. PMID:17016694
  46. [ + ] Moon KD, et al. (2005) "Molecular basis for a direct interaction between the Syk protein-tyrosine kinase and phosphoinositide 3-kinase." J Biol Chem. 280(2):1543-1551. PMID:15536084
  47. [ + ] Klammt J, et al. (2005) "Comparative analysis of the signaling capabilities of the insulin receptor-related receptor." Biochem Biophys Res Commun. 327(2):557-564. PMID:15629149
  48. [ + ] Joseph AM, et al. (2005) "Nef: "necessary and enforcing factor" in HIV infection." Curr HIV Res. 3(1):87-94. PMID:15638726
  49. [ + ] Langford D, et al. (2005) "Signalling crosstalk in FGF2-mediated protection of endothelial cells from HIV-gp120." BMC Neurosci. 6():8. PMID:15689238
  50. [ + ] Koch A, et al. (2005) "The SH2-domian-containing inositol 5-phosphatase (SHIP)-2 binds to c-Met directly via tyrosine residue 1356 and involves hepatocyte growth factor (HGF)-induced lamellipodium formation, cell scattering and cell spreading." Oncogene. 24(21):3436-3447. PMID:15735664