ABCD4 | GeneID:528646 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 528646 Official Symbol ABCD4
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family D (ALD), member 4
Chromosome N/A
Also Known As ATP-binding cassette, sub-family D, member 4
Summary N/A

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016020 Component membrane
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_001790015 XP_001790067

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000019482 MI0005057 bta-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSBTAT00000019482 MI0005451 bta-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSBTAT00000019482 MI0005452 bta-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSBTAT00000019482 MI0005453 bta-let-7b UGAGGUAGUAGGUUGUGUGGUU
ENSBTAT00000019482 MI0005454 bta-let-7c UGAGGUAGUAGGUUGUAUGGUU
ENSBTAT00000019482 MI0005026 bta-let-7d AGAGGUAGUAGGUUGCAUAGUU
ENSBTAT00000019482 MI0005455 bta-let-7e UGAGGUAGGAGGUUGUAUAGU
ENSBTAT00000019482 MI0004734 bta-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENSBTAT00000019482 MI0005062 bta-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENSBTAT00000019482 MI0005051 bta-let-7g UGAGGUAGUAGUUUGUACAGUU
ENSBTAT00000019482 MI0005065 bta-let-7i UGAGGUAGUAGUUUGUGCUGUU
ENSBTAT00000019482 MI0005025 bta-miR-98 UGAGGUAGUAAGUUGUAUUGUU
ENSBTAT00000019482 MI0004998 gga-miR-460 CCUGCAUUGUACACACUGUGUG
ENSBTAT00000019482 MI0000484 hsa-miR-188-3p CUCCCACAUGCAGGGUUUGCA
ENSBTAT00000019482 MI0000813 hsa-miR-324-5p CGCAUCCCCUAGGGCAUUGGUGU
ENSBTAT00000019482 MI0003580 hsa-miR-573 CUGAAGUGAUGUGUAACUGAUCAG
ENSBTAT00000019482 MI0003663 hsa-miR-648 AAGUGUGCAGGGCACUGGU
ENSBTAT00000019482 MI0003665 hsa-miR-650 AGGAGGCAGCGCUCUCAGGAC
ENSBTAT00000019482 MI0003834 hsa-miR-769-3p CUGGGAUCUCCGGGGUCUUGGUU
ENSBTAT00000019482 MI0005756 hsa-miR-934 UGUCUACUACUGGAGACACUGG
ENSBTAT00000019482 MI0004673 mmu-miR-669c AUAGUUGUGUGUGGAUGUGUGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Harhay GP, et al. (2005) "Characterization of 954 bovine full-CDS cDNA sequences." BMC Genomics. 6():166. PMID:16305752
  2. [ + ] Smith TP, et al. (2001) "Sequence evaluation of four pooled-tissue normalized bovine cDNA libraries and construction of a gene index for cattle." Genome Res. 11(4):626-630. PMID:11282978