ABCD3 | GeneID:526059 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 526059 Official Symbol ABCD3
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family D (ALD), member 3
Chromosome N/A
Also Known As ATP-binding cassette, sub-family D, member 3
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 2140

ID Symbol Protein Species
GeneID:5825 ABCD3 NP_002849.1 Homo sapiens
GeneID:19299 Abcd3 NP_033017.2 Mus musculus
GeneID:25270 Abcd3 NP_036936.1 Rattus norvegicus
GeneID:32992 CG12703 NP_608354.1 Drosophila melanogaster
GeneID:174126 pmp-1 NP_495407.1 Caenorhabditis elegans
GeneID:174127 pmp-2 NP_495408.1 Caenorhabditis elegans
GeneID:406803 abcd3a NP_998647.1 Danio rerio
GeneID:424487 ABCD3 NP_001012615.1 Gallus gallus
GeneID:457037 ABCD3 XP_513575.2 Pan troglodytes
GeneID:479939 ABCD3 XP_537064.2 Canis lupus familiaris
GeneID:526059 ABCD3 XP_604418.3 Bos taurus
GeneID:830144 PXA1 NP_568072.1 Arabidopsis thaliana
GeneID:1271802 AgaP_AGAP000440 XP_310656.2 Anopheles gambiae
GeneID:4337574 Os05g0107600 NP_001054425.1 Oryza sativa

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001105396 NP_001098866

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000033539 MI0005037 bta-miR-200a UAACACUGUCUGGUAACGAUGUU
ENSBTAT00000033539 MI0005020 bta-miR-369-3p AAUAAUACAUGGUUGAUCUUU
ENSBTAT00000033539 MI0000744 hsa-miR-299-5p UGGUUUACCGUCCCACAUACAU
ENSBTAT00000033539 MI0000090 hsa-miR-32 UAUUGCACAUUACUAAGUUGCA
ENSBTAT00000033539 MI0000806 hsa-miR-337-3p CUCCUAUAUGAUGCCUUUCUUC
ENSBTAT00000033539 MI0003165 hsa-miR-517b UCGUGCAUCCCUUUAGAGUGUU
ENSBTAT00000033539 MI0003686 hsa-miR-542-3p UGUGACAGAUUGAUAACUGAAA
ENSBTAT00000033539 MI0003602 hsa-miR-590-5p GAGCUUAUUCAUAAAAGUGCAG
ENSBTAT00000033539 MI0005540 hsa-miR-889 UUAAUAUCGGACAACCAUUGU
ENSBTAT00000033539 MI0005507 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSBTAT00000033539 MI0005508 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSBTAT00000033539 MI0005509 mmu-miR-466f-3p CAUACACACACACAUACACAC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene