ABCF1 | GeneID:525343 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 525343 Official Symbol ABCF1
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family F (GCN20), member 1
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 849

ID Symbol Protein Species
GeneID:23 ABCF1 NP_001020262.1 Homo sapiens
GeneID:32112 CG1703 NP_572736.1 Drosophila melanogaster
GeneID:85493 Abcf1 XP_001062137.1 Rattus norvegicus
GeneID:179748 abcf-1 NP_506192.1 Caenorhabditis elegans
GeneID:224742 Abcf1 NP_038882.1 Mus musculus
GeneID:406467 abcf1 NP_998351.1 Danio rerio
GeneID:462543 ABCF1 NP_001035838.1 Pan troglodytes
GeneID:474826 ABCF1 XP_532056.2 Canis lupus familiaris
GeneID:525343 ABCF1 XP_603695.3 Bos taurus
GeneID:824619 ATGCN4 NP_567001.1 Arabidopsis thaliana
GeneID:1280440 AgaP_AGAP012249 XP_320293.2 Anopheles gambiae
GeneID:2539509 SPCC825.01 NP_588051.1 Schizosaccharomyces pombe
GeneID:4333216 Os03g0441500 NP_001050461.1 Oryza sativa

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_001254427 XP_001254428
2 XM_603695 XP_603695

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000009098 MI0004736 bta-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENSBTAT00000009098 MI0005456 bta-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENSBTAT00000009098 MI0005006 bta-miR-107 AGCAGCAUUGUACAGGGCUAUC
ENSBTAT00000009098 MI0005458 bta-miR-15a UAGCAGCACAUAAUGGUUUGU
ENSBTAT00000009098 MI0005012 bta-miR-15b UAGCAGCACAUCAUGGUUUACA
ENSBTAT00000009098 MI0004759 bta-miR-205 UCCUUCAUUCCACCGGAGUCUG
ENSBTAT00000009098 MI0004733 bta-miR-29a CUAGCACCAUCUGAAAUCGGUUA
ENSBTAT00000009098 MI0005043 bta-miR-29b UAGCACCAUUUGAAAUCAGUGUUU
ENSBTAT00000009098 MI0005044 bta-miR-29c UAGCACCAUUUGAAAUCGGUUA
ENSBTAT00000009098 MI0005467 bta-miR-497 CAGCAGCACACUGUGGUUUGUA
ENSBTAT00000009098 MI0000086 hsa-miR-28-3p CACUAGAUUGUGAGCUCCUGGA
ENSBTAT00000009098 MI0001446 hsa-miR-424 CAGCAGCAAUUCAUGUUUUGAA
ENSBTAT00000009098 MI0002470 hsa-miR-486-5p UCCUGUACUGAGCUGCCCCGAG
ENSBTAT00000009098 MI0005717 hsa-miR-509-3-5p UACUGCAGACGUGGCAAUCAUG
ENSBTAT00000009098 MI0003196 hsa-miR-509-5p UACUGCAGACAGUGGCAAUCA
ENSBTAT00000009098 MI0005530 hsa-miR-509-5p UACUGCAGACAGUGGCAAUCA
ENSBTAT00000009098 MI0003180 hsa-miR-516a-5p UUCUCGAGGAAAGAAGCACUUUC
ENSBTAT00000009098 MI0003181 hsa-miR-516a-5p UUCUCGAGGAAAGAAGCACUUUC
ENSBTAT00000009098 MI0003163 hsa-miR-521 AACGCACUUCCCUUUAGAGUGU
ENSBTAT00000009098 MI0003176 hsa-miR-521 AACGCACUUCCCUUUAGAGUGU
ENSBTAT00000009098 MI0003679 hsa-miR-549 UGACAACUAUGGAUGAGCUCU
ENSBTAT00000009098 MI0003617 hsa-miR-604 AGGCUGCGGAAUUCAGGAC
ENSBTAT00000009098 MI0003624 hsa-miR-611 GCGAGGACCCCUCGGGGUCUGAC
ENSBTAT00000009098 MI0003637 hsa-miR-623 AUCCCUUGCAGGGGCUGUUGGGU
ENSBTAT00000009098 MI0003661 hsa-miR-646 AAGCAGCUGCCUCUGAGGC
ENSBTAT00000009098 MI0003761 hsa-miR-668 UGUCACUCGGCUCGGCCCACUAC
ENSBTAT00000009098 MI0005562 hsa-miR-887 GUGAACGGGCGCCAUCCCGAGG
ENSBTAT00000009098 MI0005538 hsa-miR-892b CACUGGCUCCUUUCUGGGUAGA
ENSBTAT00000009098 MI0000590 mmu-miR-322 CAGCAGCAAUUCAUGUUUUGGA
ENSBTAT00000009098 MI0004553 mmu-miR-666-3p GGCUGCAGCGUGAUCGCCUGCU
ENSBTAT00000009098 MI0004635 mmu-miR-678 GUCUCGGUGCAAGGACUGGAGG
ENSBTAT00000009098 MI0004652 mmu-miR-687 CUAUCCUGGAAUGCAGCAAUGA
ENSBTAT00000009098 MI0004681 mmu-miR-697 AACAUCCUGGUCCUGUGGAGA
ENSBTAT00000009098 MI0004698 mmu-miR-713 UGCACUGAAGGCACACAGC
ENSBTAT00000009098 MI0004699 mmu-miR-714 CGACGAGGGCCGGUCGGUCGC
ENSBTAT00000009098 MI0004704 mmu-miR-717 CUCAGACAGAGAUACCUUCUCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene