ABCB4 | GeneID:5244 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 5244 Official Symbol ABCB4
Locus N/A Gene Type protein-coding
Synonyms ABC21; GBD1; MDR2; MDR2/3; MDR3; PFIC-3; PGY3
Full Name ATP-binding cassette, sub-family B (MDR/TAP), member 4
Description ATP-binding cassette, sub-family B (MDR/TAP), member 4
Chromosome 7q21.1
Also Known As ATP-binding cassette, subfamily B, member 4; OTTHUMP00000025014; P glycoprotein 3/multiple drug resistance 3; P-glycoprotein-3/multiple drug resistance-3; multidrug resistance protein 3; multiple drug resistance 3
Summary The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen presentation. This gene encodes a full transporter and member of the p-glycoprotein family of membrane proteins with phosphatidylcholine as its substrate. The function of this protein has not yet been determined; however, it may involve transport of phospholipids from liver hepatocytes into bile. Alternative splicing of this gene results in several products of undetermined function. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 113698

ID Symbol Protein Species
GeneID:5244 ABCB4 NP_061337.1 Homo sapiens
GeneID:18670 Abcb4 NP_032856.1 Mus musculus
GeneID:24891 Abcb4 NP_036822.1 Rattus norvegicus
GeneID:36428 Mdr49 NP_523724.2 Drosophila melanogaster
GeneID:748364 ABCB4 XP_001160982.1 Pan troglodytes
GeneID:819314 MDR4/PGP4 NP_182223.1 Arabidopsis thaliana
GeneID:825388 PGP21 NP_191774.1 Arabidopsis thaliana
GeneID:826951 MDR3/PGP3 NP_192091.1 Arabidopsis thaliana
GeneID:826974 PGP5 NP_192092.1 Arabidopsis thaliana
GeneID:827530 PGP9 NP_193539.2 Arabidopsis thaliana
GeneID:834697 PGP7 NP_199466.1 Arabidopsis thaliana
GeneID:839282 PGP12 NP_171754.1 Arabidopsis thaliana
GeneID:839353 PGP11 NP_171753.1 Arabidopsis thaliana
GeneID:1276325 AgaP_AGAP005639 XP_315658.1 Anopheles gambiae
GeneID:4323895 Os01g0695700 NP_001043962.1 Oryza sativa

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab71792 ABCB4 antibody (ab71792); Rabbit polyclonal to ABCB4
2 abcam ab24108 ABCB4 antibody [P3II-26] (ab24108); Mouse monoclonal [P3II-26] to ABCB4
3 abgent AP6112a ABCB4 Antibody (Center); Purified Rabbit Polyclonal Antibody (Pab)
4 acris AP13075PU-N ABCB4 / MDR3 (Center); antibody Ab
5 scbt ABCB4 ABCB4 Antibody / ABCB4 Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of ABCB4 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABCB4 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016324 Component apical plasma membrane
GO:0000139 Component Golgi membrane
GO:0005887 Component integral to plasma membrane
GO:0046581 Component intercellular canaliculus
GO:0016020 Component membrane
GO:0005624 Component membrane fraction
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0016787 Function hydrolase activity
GO:0000166 Function nucleotide binding
GO:0005515 Function protein binding
GO:0008559 Function xenobiotic-transporting ATPase activity
GO:0006629 Process lipid metabolic process
GO:0042493 Process response to drug
GO:0051384 Process response to glucocorticoid stimulus
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_000443  UCSC Browser NP_000434
2 NM_018849  UCSC Browser NP_061337 P21439   A4D1D3  
3 NM_018850  UCSC Browser NP_061338

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000265723 MI0000452 hsa-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
ENST00000265723 MI0000453 hsa-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
ENST00000265723 MI0000805 hsa-miR-342-3p UCUCACACAGAAAUCGCACCCGU
ENST00000265723 MI0000785 hsa-miR-377 AUCACACAAAGGCAACUUUUGU
ENST00000265723 MI0002470 hsa-miR-486-5p UCCUGUACUGAGCUGCCCCGAG
ENST00000265723 MI0003195 hsa-miR-508-3p UGAUUGUAGCCUUUUGGAGUAGA
ENST00000265723 MI0000466 hsa-miR-9 UCUUUGGUUAUCUAGCUGUAUGA
ENST00000265723 MI0000467 hsa-miR-9 UCUUUGGUUAUCUAGCUGUAUGA
ENST00000265723 MI0000468 hsa-miR-9 UCUUUGGUUAUCUAGCUGUAUGA
ENST00000265723 MI0000630 mmu-miR-344 UGAUCUAGCCAAAGCCUGACUGU
ENST00000265723 MI0005495 mmu-miR-344 UGAUCUAGCCAAAGCCUGACUGU
ENST00000265723 MI0002400 mmu-miR-465a-5p UAUUUAGAAUGGCACUGAUGUGA
ENST00000265723 MI0005498 mmu-miR-465b-5p UAUUUAGAAUGGUGCUGAUCUG
ENST00000265723 MI0005499 mmu-miR-465b-5p UAUUUAGAAUGGUGCUGAUCUG
ENST00000265723 MI0005500 mmu-miR-465c-5p UAUUUAGAAUGGCGCUGAUCUG
ENST00000265723 MI0005501 mmu-miR-465c-5p UAUUUAGAAUGGCGCUGAUCUG
ENST00000265723 MI0005204 mmu-miR-805 GAAUUGAUCAGGACAUAGGG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

BC020618   BC042531   M23234   NM_000443   NM_018849   NM_018850   X06181   Z35284  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
1,9-dideoxyforskolin
  • 1,9-dideoxyforskolin results in decreased activity of ABCB4 protein
12202523
1-Naphthylisothiocyanate
  • 1-Naphthylisothiocyanate does not affect the expression of ABCB4 protein
15955216
1-Naphthylisothiocyanate
  • 1-Naphthylisothiocyanate results in increased expression of ABCB4 mRNA
14623915
2,4,5-Trichlorophenoxyacetic Acid
  • 2,4,5-Trichlorophenoxyacetic Acid results in increased expression of ABCB4 mRNA
9210621
2,4-Dichlorophenoxyacetic Acid
  • 2,4-Dichlorophenoxyacetic Acid results in increased expression of ABCB4 mRNA
9210621
6-ethylchenodeoxycholic acid
  • 6-ethylchenodeoxycholic acid results in increased expression of ABCB4 mRNA
15644430
albendazole sulfoxide
  • ABCB4 protein does not affect the transport of albendazole sulfoxide
15703302
alpha-hexachlorocyclohexane
  • alpha-hexachlorocyclohexane results in increased expression of ABCB4 mRNA
16940010
atorvastatin
  • atorvastatin results in increased expression of ABCB4 mRNA
  • atorvastatin results in increased expression of ABCB4 protein
15986414
Bezafibrate
  • Bezafibrate results in increased expression of ABCB4 mRNA
15588777, 14685799, 15258199
Bezafibrate
  • Bezafibrate affects the localization of ABCB4 protein
  • Bezafibrate does not affect the expression of ABCB4 protein
  • Bezafibrate results in increased expression of ABCB4 mRNA
15258199
Bezafibrate
  • Bezafibrate results in increased expression of ABCB4 mRNA
15242490
Bezafibrate
  • Bezafibrate results in increased expression of ABCB4 protein
  • [Bezafibrate co-treated with Chenodeoxycholic Acid] results in increased expression of ABCB4 mRNA
15588777
Bile Acids and Salts
  • Bile Acids and Salts results in increased expression of ABCB4 protein
11835266
Bile Acids and Salts
  • ABCB4 affects the secretion of Bile Acids and Salts
12967592
bisindolylmaleimide I
  • bisindolylmaleimide I inhibits the reaction [Tetradecanoylphorbol Acetate results in decreased expression of ABCB4 mRNA]
11331069
calphostin C
  • calphostin C inhibits the reaction [Tetradecanoylphorbol Acetate results in decreased expression of ABCB4 mRNA]
11331069
Carbon Tetrachloride
  • Carbon Tetrachloride results in decreased expression of ABCB4 mRNA
15963578
Chenodeoxycholic Acid
  • [Bezafibrate co-treated with Chenodeoxycholic Acid] results in increased expression of ABCB4 mRNA
15588777
Chenodeoxycholic Acid
  • [[Chenodeoxycholic Acid binds to and results in increased activity of NR1H4 protein] which binds to ABCB4 promoter] which results in increased expression of ABCB4 mRNA
14527955
Chenodeoxycholic Acid
  • Chenodeoxycholic Acid results in increased expression of ABCB4 mRNA
14623915, 14527955
Cholesterol
  • ABCB4 protein affects the export of Cholesterol
15019087
Cholic Acid
  • Cholic Acid does not affect the expression of ABCB4 mRNA
  • Cholic Acid does not affect the expression of ABCB4 protein
11438506
Cholic Acid
  • ABCB4 affects the secretion of Cholic Acid
12967592
ciprofibrate
  • ciprofibrate results in increased expression of ABCB4 mRNA
  • ciprofibrate results in increased expression of ABCB4 protein
12381268
Clofibric Acid
  • Clofibric Acid results in increased expression of ABCB4 mRNA
12512040
Clofibric Acid
  • Clofibric Acid results in increased activity of ABCB4 protein
12381268
Clofibric Acid
  • [Diethylnitrosamine co-treated with Clofibric Acid] affects the expression of ABCB4 mRNA
17602206
Cycloheximide
  • Cycloheximide inhibits the reaction [Tetradecanoylphorbol Acetate results in decreased expression of ABCB4 mRNA]
11331069
Dexamethasone
  • Dexamethasone results in increased expression of ABCB4 mRNA
12429353
Dietary Fats
  • Dietary Fats results in increased expression of ABCB4 mRNA
15238619
Diethylhexyl Phthalate
  • Diethylhexyl Phthalate results in increased expression of ABCB4 mRNA
9210621
Diethylnitrosamine
  • [Diethylnitrosamine co-treated with Clofibric Acid] affects the expression of ABCB4 mRNA
17602206
dinonylphthalate
  • dinonylphthalate results in increased expression of ABCB4 mRNA
9210621
Diosgenin
  • Diosgenin does not affect the expression of ABCB4 mRNA
15611112
Doxorubicin
  • ABCB4 protein results in chemical resistance to Doxorubicin
11313874
Doxorubicin
  • Doxorubicin results in increased expression of ABCB4 mRNA
16579640
Doxorubicin
  • Forskolin inhibits the reaction [Doxorubicin results in increased expression of ABCB4 mRNA]
12926078
estradiol-17 beta-glucuronide
  • ABCB4 protein affects the export of estradiol-17 beta-glucuronide
11302927
Ethinyl Estradiol
  • Ethinyl Estradiol affects the expression of ABCB4 mRNA
15212814
Ethinyl Estradiol
  • Ethinyl Estradiol results in decreased expression of ABCB4 mRNA
16940010
Fish Oils
  • Fish Oils results in increased expression of ABCB4 mRNA
9210621
Forskolin
  • Forskolin does not affect the expression of ABCB4 protein
  • Forskolin inhibits the reaction [Doxorubicin results in increased expression of ABCB4 mRNA]
  • Forskolin results in decreased expression of ABCB4 mRNA
  • H 89 inhibits the reaction [Forskolin results in decreased expression of ABCB4 mRNA]
12926078
furan
  • furan results in increased expression of ABCB4 mRNA
15120968
Gemfibrozil
  • Gemfibrozil results in increased expression of ABCB4 mRNA
14685799
Glutathione
  • ABCB4 protein affects the export of Glutathione
11302927
GW 4064
  • GW 4064 results in increased expression of ABCB4 mRNA
14623915, 14527955
GW 4064
  • GW 4064 results in increased expression of ABCB4 mRNA
15644430
GW 4064
  • [[GW 4064 binds to and results in increased activity of NR1H4 protein] which binds to ABCB4 promoter] which results in increased expression of ABCB4 mRNA
14527955
H 89
  • H 89 inhibits the reaction [Forskolin results in decreased expression of ABCB4 mRNA]
12926078
Herbicides
  • Herbicides results in increased expression of ABCB4 mRNA
9210621
Indocyanine Green
  • ABCB4 protein affects the export of Indocyanine Green
11302927
Lipopolysaccharides
  • Lipopolysaccharides results in decreased expression of ABCB4 protein
12795754
Lipopolysaccharides
  • Lipopolysaccharides affects the expression of ABCB4 protein
  • Lipopolysaccharides results in decreased expression of ABCB4 mRNA
15778272
Methapyrilene
  • Methapyrilene results in increased expression of ABCB4 mRNA
15120968
miltefosine
  • ABCB4 protein does not affect the response to chemical miltefosine
11355955
muricholic acid
  • ABCB4 affects the secretion of muricholic acid
12967592
Omeprazole
  • Omeprazole results in decreased expression of ABCB4 mRNA
12040753
oxfendazole
  • ABCB4 protein does not affect the transport of oxfendazole
15703302
phorbol-12,13-didecanoate
  • phorbol-12,13-didecanoate does not affect the expression of ABCB4 mRNA
11331069
Phosphatidylcholines
  • ABCB4 protein affects the export of Phosphatidylcholines
15696852
Phosphatidylcholines
  • ABCB4 protein affects the transport of Phosphatidylcholines
11745043
Phospholipids
  • ABCB4 protein affects the transport of Phospholipids
15582136, 14527955
Phospholipids
  • ABCB4 protein affects the export of Phospholipids
15019087
Phospholipids
  • ABCB4 protein affects the export of Phospholipids
15826951
pirinixic acid
  • pirinixic acid results in increased expression of ABCB4 mRNA
18301758, 12381268
Pravastatin
  • Pravastatin results in increased expression of ABCB4 mRNA
15242490
Procetofen
  • Procetofen results in increased expression of ABCB4 mRNA
14685799
quinidinium
  • ABCB4 protein does not affect the transport of quinidinium
11934808
Quinine
  • ABCB4 protein does not affect the transport of Quinine analog
11934808
Soybean Oil
  • Soybean Oil affects the expression of ABCB4 mRNA
15770074
Sterols
  • ABCB4 protein affects the export of Sterols
15930516
Streptozocin
  • Streptozocin results in increased expression of ABCB4 mRNA
  • Streptozocin results in increased expression of ABCB4 protein
12055592
Sulfobromophthalein
  • ABCB4 protein affects the transport of Sulfobromophthalein
15304119
Tamoxifen
  • Tamoxifen results in decreased activity of ABCB4 protein
12202523
Taurochenodeoxycholic Acid
  • Taurochenodeoxycholic Acid does not affect the expression of ABCB4 protein
11672435
Taurocholic Acid
  • Taurocholic Acid does not affect the expression of ABCB4 protein
12644037
Taurocholic Acid
  • Taurocholic Acid results in increased expression of ABCB4 protein
11113123
tauromuricholic acid
  • tauromuricholic acid does not affect the expression of ABCB4 protein
12644037, 11672435
tauroursodeoxycholic acid
  • tauroursodeoxycholic acid does not affect the expression of ABCB4 protein
12644037, 11672435
Technetium Tc 99m Sestamibi
  • ABCB4 protein affects the export of Technetium Tc 99m Sestamibi
12536246
Tetradecanoylphorbol Acetate
  • Cycloheximide inhibits the reaction [Tetradecanoylphorbol Acetate results in decreased expression of ABCB4 mRNA]
  • Tetradecanoylphorbol Acetate results in decreased expression of ABCB4 mRNA
  • bisindolylmaleimide I inhibits the reaction [Tetradecanoylphorbol Acetate results in decreased expression of ABCB4 mRNA]
  • calphostin C inhibits the reaction [Tetradecanoylphorbol Acetate results in decreased expression of ABCB4 mRNA]
11331069
Ursodeoxycholic Acid
  • Ursodeoxycholic Acid does not affect the expression of ABCB4 mRNA
  • Ursodeoxycholic Acid does not affect the expression of ABCB4 protein
11438506
Verapamil
  • Verapamil results in decreased activity of ABCB4 protein
12202523
Vincristine
  • ABCB4 protein does not affect the transport of Vincristine
11934808
Vitamin A
  • Vitamin A does not affect the expression of ABCB4 mRNA
15327746

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
CHOLESTASIS, INTRAHEPATIC, OF PREGNANCY marker
CHOLESTASIS, PROGRESSIVE FAMILIAL INTRAHEPATIC 3 marker
GALLBLADDER DISEASE 1 marker
Anemia inferred via Vitamin A 16960172
Anemia, Iron-Deficiency inferred via Vitamin A 16960172
Asthma inferred via Vitamin A 16732791
Bronchopulmonary Dysplasia inferred via Vitamin A 17426644, 17377406
Child Nutrition Disorders inferred via Vitamin A 16153327
Cholestasis inferred via Vitamin A 16175620
Cleft Palate inferred via Vitamin A 16054864
Colonic Neoplasms inferred via Vitamin A 17219422, 16267017
Diabetes Mellitus, Type 1 inferred via Vitamin A 16506275
Dry Eye Syndromes inferred via Vitamin A 16146918
Ectromelia inferred via Vitamin A 16054864
Fetal Resorption inferred via Vitamin A 16054864
Heart Defects, Congenital inferred via Vitamin A 16080930
Hernia, Diaphragmatic inferred via Vitamin A 17436238, 16863852, 16292552, 16877224, 16490937
HIV Infections inferred via Vitamin A 16960176
HIV Seropositivity inferred via Vitamin A 17209195
Hypervitaminosis A inferred via Vitamin A 16054864
Limb Deformities, Congenital inferred via Vitamin A 16054864
Liver Cirrhosis inferred via Vitamin A 16256175
Liver Cirrhosis, Experimental inferred via Vitamin A 16248980
Liver Diseases inferred via Vitamin A 16175620
Liver Diseases, Alcoholic inferred via Vitamin A 16762690
Liver Neoplasms, Experimental inferred via Vitamin A 17113696
Lung Diseases inferred via Vitamin A 16863852
Multiple Myeloma inferred via Vitamin A 16374440
Neural Tube Defects inferred via Vitamin A 17400914
Respiratory Distress Syndrome, Newborn inferred via Vitamin A 16877224
Vitamin A Deficiency inferred via Vitamin A 16960172, 16175781, 16146918
Carcinoma, Renal Cell inferred via Vincristine 16201981
Hodgkin Disease inferred via Vincristine 17606976, 16794504, 16135485, 15147373
Melanoma, Amelanotic inferred via Vincristine 15990972
Myocardial Infarction inferred via Vincristine 17284715
Cholestasis inferred via Ursodeoxycholic Acid 16487557
Cholestasis, Intrahepatic inferred via Ursodeoxycholic Acid 14728856
Lung Neoplasms inferred via Tetradecanoylphorbol Acetate 11807781
Mammary Neoplasms, Experimental inferred via Tetradecanoylphorbol Acetate 8985016
Pancreatic Neoplasms inferred via Tetradecanoylphorbol Acetate 15976015
Skin Neoplasms inferred via Tetradecanoylphorbol Acetate 8985016, 11807781
Breast Neoplasms inferred via Tamoxifen 16202921, 15668708, 17440819, 17893378, 17261762, 17049068, 16873071, 16818667, 11161223, 17242785, 15565566
Carcinoma, Hepatocellular inferred via Tamoxifen 16924424
Carcinoma, Transitional Cell inferred via Tamoxifen 17572228
Endometrial Neoplasms inferred via Tamoxifen 16202921, 17893378
Fatty Liver inferred via Tamoxifen 14986274
Female Urogenital Diseases inferred via Tamoxifen 16709447
Lipidoses inferred via Tamoxifen 15342952
Liver Cirrhosis, Experimental inferred via Tamoxifen 18564211
Liver Neoplasms inferred via Tamoxifen 16684651
Mammary Neoplasms, Experimental inferred via Tamoxifen 11731420, 14580682, 16827153
Melanoma inferred via Tamoxifen 12393984
Melanoma, Amelanotic inferred via Tamoxifen 15990972
Spermatocele inferred via Tamoxifen 16709447
Urinary Bladder Neoplasms inferred via Tamoxifen 16712894, 17572228
Carcinoid Tumor inferred via Streptozocin 16051944
Diabetes Mellitus inferred via Streptozocin 16285004
Diabetes Mellitus, Experimental inferred via Streptozocin 16286809, 15298345
Myotonia Congenita inferred via Quinine 1896199
Dyslipidemias inferred via Procetofen 16707586
Endometrial Neoplasms inferred via Procetofen 16569247
Hypercholesterolemia inferred via Pravastatin 17188708
Myocardial Infarction inferred via Pravastatin 17188708
Edema inferred via pirinixic acid 12083418
Liver Neoplasms inferred via pirinixic acid 15890375
Liver Cirrhosis, Experimental inferred via Phosphatidylcholines 16169303
Duodenal Ulcer inferred via Omeprazole 15991576
Stomach Ulcer inferred via Omeprazole 15991576
Liver Neoplasms inferred via Methapyrilene 15890375
Hemolytic-Uremic Syndrome inferred via Lipopolysaccharides 16366002
Inflammation inferred via Lipopolysaccharides 17255318, 17963957
Iron Metabolism Disorders inferred via Lipopolysaccharides 17255318
Respiratory Hypersensitivity inferred via Lipopolysaccharides 10835634
Carcinoma, Squamous Cell inferred via Glutathione 17015178
Dyslipidemias inferred via Gemfibrozil 16707586
Hypersensitivity, Delayed inferred via Fish Oils 11484837
Acne Vulgaris inferred via Ethinyl Estradiol 17505938
Adenocarcinoma inferred via Ethinyl Estradiol 14692618
Arteriosclerosis inferred via Ethinyl Estradiol 11256880
Arthritis, Experimental inferred via Ethinyl Estradiol 15885639
Cholestasis inferred via Ethinyl Estradiol 17110522, 16919318, 17681005, 16105132, 17333356, 15861022, 11677210
Encephalomyelitis, Autoimmune, Experimental inferred via Ethinyl Estradiol 12538720
Fatty Liver inferred via Ethinyl Estradiol 15345470
Hypospadias inferred via Ethinyl Estradiol 16569931, 16945680
Infertility, Female inferred via Ethinyl Estradiol 12013081
Infertility, Male inferred via Ethinyl Estradiol 17937319
Panic Disorder inferred via Ethinyl Estradiol 11578682
Pruritus inferred via Ethinyl Estradiol 16919318, 15861022
Spermatocele inferred via Ethinyl Estradiol 16709447
Thrombophilia inferred via Ethinyl Estradiol 11994571
Thrombosis inferred via Ethinyl Estradiol 15669648
Uterine Neoplasms inferred via Ethinyl Estradiol 14692618
Venous Thrombosis inferred via Ethinyl Estradiol 15869587
Adenocarcinoma inferred via Doxorubicin 17418594
Bone Marrow Neoplasms inferred via Doxorubicin 14601052
Brain Neoplasms inferred via Doxorubicin 17150277
Breast Neoplasms inferred via Doxorubicin 15692762, 15993339, 15634643, 15567936, 15994142, 15668708, 16264153, 18234424, 17369602, 16935488, 15136595, 11325840, 16322301, 16096432, 17426702, 17983394, 16826403, 18382427, 18628466, 15939500
Carcinoid Tumor inferred via Doxorubicin 16051944
Carcinoma, Hepatocellular inferred via Doxorubicin 18059187, 16023760, 16234567, 17876044
Carcinoma, Renal Cell inferred via Doxorubicin 16201981
Cardiomyopathies inferred via Doxorubicin 16952015, 16651473, 17351982, 17131338, 16455267, 18627295, 17329180, 16731534, 17974986, 17382496, 15505089, 16278810, 15476868, 16269455, 16109756, 16242529, 16364871, 15811867, 17308081, 17007740
Cardiomyopathy, Dilated inferred via Doxorubicin 17334414, 16243910
Colorectal Neoplasms inferred via Doxorubicin 18259882
Drug Toxicity inferred via Doxorubicin 18602426
Endometrial Neoplasms inferred via Doxorubicin 17359293
Endomyocardial Fibrosis inferred via Doxorubicin 18037988
Glioblastoma inferred via Doxorubicin 17150277
Head and Neck Neoplasms inferred via Doxorubicin 15692506
Heart Diseases inferred via Doxorubicin 16707910, 16244372, 16244371, 16144979, 16330681, 16879835
Hemangiosarcoma inferred via Doxorubicin 15692506
Hepatitis, Toxic inferred via Doxorubicin 17416283
Hodgkin Disease inferred via Doxorubicin 17606976, 18501091, 15147373
Kidney Diseases inferred via Doxorubicin 16775033, 15369732
Kidney Failure inferred via Doxorubicin 17922066
Kidney Failure, Chronic inferred via Doxorubicin 16707910
Leukemia, Erythroblastic, Acute inferred via Doxorubicin 16085563
Liver Cirrhosis, Experimental inferred via Doxorubicin 16595196, 16439617
Liver Neoplasms, Experimental inferred via Doxorubicin 17085340, 16842330
Lung Neoplasms inferred via Doxorubicin 17418594
Lymphoma inferred via Doxorubicin 16098063
Lymphoma, Non-Hodgkin inferred via Doxorubicin 17654614
Lymphoma, T-Cell inferred via Doxorubicin 15621674
Mammary Neoplasms, Experimental inferred via Doxorubicin 15458769
Melanoma inferred via Doxorubicin 16827129
Mucositis inferred via Doxorubicin 17415656
Neoplasm Metastasis inferred via Doxorubicin 18259882
Nephrotic Syndrome inferred via Doxorubicin 15640375, 16889571
Neuroblastoma inferred via Doxorubicin 15555623
Osteosarcoma inferred via Doxorubicin 15930896
Phyllodes Tumor inferred via Doxorubicin 17983394
Prostatic Neoplasms inferred via Doxorubicin 15897917, 15749863, 18437689, 16729912, 16888761, 16868541
Sarcoma inferred via Doxorubicin 18313854, 15625365, 15675481, 17710206, 17203757, 16767912
Sarcoma, Ewing's inferred via Doxorubicin 14601052, 16326096
Sarcoma, Kaposi inferred via Doxorubicin 17846226
Skin Neoplasms inferred via Doxorubicin 15692506
Soft Tissue Neoplasms inferred via Doxorubicin 16767912, 17203757, 15625365
Thyroid Neoplasms inferred via Doxorubicin 17909728, 16010429
Urinary Bladder Neoplasms inferred via Doxorubicin 17653716
Ventricular Dysfunction, Left inferred via Doxorubicin 17334414, 16364871
Cholestasis inferred via Diosgenin 16105132
Adenoma inferred via Diethylnitrosamine 10737359
Carcinoma, Hepatocellular inferred via Diethylnitrosamine 16878318, 10737359, 10672840, 17428255, 11831363
Liver Neoplasms inferred via Diethylnitrosamine 2422723, 15885732, 18648771, 10737359, 12112319, 16942905
Liver Neoplasms, Experimental inferred via Diethylnitrosamine 16267830, 3124819, 16842330
Dermatitis, Atopic inferred via Diethylhexyl Phthalate 16882537
Arteriosclerosis inferred via Dietary Fats 15238619
Dyslipidemias inferred via Dietary Fats 18367378
Insulin Resistance inferred via Dietary Fats 18457598
Obesity inferred via Dietary Fats 18457598, 17217161
Colonic Neoplasms inferred via Dexamethasone 15824018
Liver Cirrhosis, Experimental inferred via Dexamethasone 16718785
Lung Neoplasms inferred via Dexamethasone 15824018, 11195469
Multiple Myeloma inferred via Dexamethasone 15867202, 16118317, 15744524
Respiratory Distress Syndrome, Adult inferred via Dexamethasone 11700416
Liver Neoplasms inferred via Clofibric Acid 17602206
Atherosclerosis inferred via Cholesterol 16632123
Hypercholesterolemia inferred via Cholesterol 16933029
Learning Disorders inferred via Cholesterol 17134702
Niemann-Pick Disease, Type C inferred via Cholesterol 9802331
Tuberculosis inferred via Chenodeoxycholic Acid 16040207
Carbon Tetrachloride Poisoning inferred via Carbon Tetrachloride 16192424, 16124888, 16227642, 15700767, 10355542, 16011737, 16097048, 16050911, 15673190
Fatty Liver inferred via Carbon Tetrachloride 16045604, 12795759, 61145, 12631006, 17595544, 15959796, 16239168
Hepatitis, Toxic inferred via Carbon Tetrachloride 17522070, 16177239, 16227642, 15027814, 15968718, 15998439, 11566570
Hyperbilirubinemia inferred via Carbon Tetrachloride 16899240
Liver Cirrhosis inferred via Carbon Tetrachloride 17174718, 16943688, 17334410, 16221502, 16239168
Liver Cirrhosis, Experimental inferred via Carbon Tetrachloride 16192424, 16116963, 17525996, 17557913, 18156304, 16638106, 18418968, 17721639, 18277467, 18205269, 14716496, 15730626, 12632514, 15052691, 12632512, 17766677, 17944888, 18395914, 18279442, 16027843, 15996030, 16033810, 17565644, 17869086, 17708605, 12667390, 14748882, 13678700, 15818738, 17631135, 16097048, 15673190, 12649538, 12445421, 12445418, 15959796, 12898905, 18317297, 17761835, 14620537, 18472332, 14716833, 16015684, 12741479, 14724832, 18472094, 15931870, 17698563, 15893842, 12958196, 17640975, 18376398, 12389079, 18187930, 18210741, 18412020, 17714472, 14512876, 12609069, 18166357, 17922224, 18420326, 15876570, 16136751, 17481882, 17900296, 15123356, 18339082, 18429990, 12546737, 18006644, 18481824, 15057751, 12586293, 18054572, 10355542, 16011737, 18251166, 17823541, 12666154, 18395095, 17976157, 17805973, 16248980, 15925388
Liver Diseases inferred via Carbon Tetrachloride 16246199, 15830285, 16964402, 15720792, 17285989
Liver Failure inferred via Carbon Tetrachloride 15123358
Liver Failure, Acute inferred via Carbon Tetrachloride 14706259, 16899240
Liver Neoplasms, Experimental inferred via Carbon Tetrachloride 15583823
Coronary Artery Disease inferred via atorvastatin 16368305
Heart Failure inferred via atorvastatin 16360360
Hyperlipoproteinemia Type II inferred via atorvastatin 16238680
Liver Cirrhosis, Experimental inferred via atorvastatin 17347453
Liver Cirrhosis, Experimental inferred via 6-ethylchenodeoxycholic acid 15860571, 15980055
Agricultural Workers' Diseases inferred via 2,4-Dichlorophenoxyacetic Acid 16132792
Infertility, Male inferred via 2,4-Dichlorophenoxyacetic Acid 12948887
Lymphoma, Non-Hodgkin inferred via 2,4-Dichlorophenoxyacetic Acid 16132792
Cholestasis, Intrahepatic inferred via 1-Naphthylisothiocyanate 10220858
Hepatitis, Toxic inferred via 1-Naphthylisothiocyanate 17522070
Liver Diseases inferred via 1-Naphthylisothiocyanate 17184895

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Nakken KE, et al. (2009) "ABCB4 sequence variations in young adults with cholesterol gallstone disease." Liver Int. 29(5):743-747. PMID:19018976
  2. [ + ] Acalovschi M, et al. (2009) "Common variants of ABCB4 and ABCB11 and plasma lipid levels: a study in sib pairs with gallstones, and controls." Lipids. 44(6):521-526. PMID:19408031
  3. [ + ] Saito A, et al. (2009) "Association study between single-nucleotide polymorphisms in 199 drug-related genes and commonly measured quantitative traits of 752 healthy Japanese subjects." J Hum Genet. 54(6):317-323. PMID:19343046
  4. [ + ] Hardikar W, et al. (2009) "Intrahepatic cholestasis of pregnancy: when should you look further?" World J Gastroenterol. 15(9):1126-1129. PMID:19266607
  5. [ + ] Delaunay JL, et al. (2009) "A missense mutation in ABCB4 gene involved in progressive familial intrahepatic cholestasis type 3 leads to a folding defect that can be rescued by low temperature." Hepatology. 49(4):1218-1227. PMID:19185004
  6. [ + ] Ziol M, et al. (2008) "ABCB4 heterozygous gene mutations associated with fibrosing cholestatic liver disease in adults." Gastroenterology. 135(1):131-141. PMID:18482588
  7. [ + ] Gotthardt D, et al. (2008) "A mutation in the canalicular phospholipid transporter gene, ABCB4, is associated with cholestasis, ductopenia, and cirrhosis in adults." Hepatology. 48(4):1157-1166. PMID:18781607
  8. [ + ] Ohishi Y, et al. (2008) "Single-nucleotide polymorphism analysis of the multidrug resistance protein 3 gene for the detection of clinical progression in Japanese patients with primary biliary cirrhosis." Hepatology. 48(3):853-862. PMID:18671305
  9. [ + ] Lu Y, et al. (2008) "Multiple genetic variants along candidate pathways influence plasma high-density lipoprotein cholesterol concentrations." J Lipid Res. 49(12):2582-2589. PMID:18660489
  10. [ + ] Floreani A, et al. (2008) "Hepatobiliary phospholipid transporter ABCB4, MDR3 gene variants in a large cohort of Italian women with intrahepatic cholestasis of pregnancy." Dig Liver Dis. 40(5):366-370. PMID:18083082
  11. [ + ] Schneider G, et al. (2007) "Linkage between a new splicing site mutation in the MDR3 alias ABCB4 gene and intrahepatic cholestasis of pregnancy." Hepatology. 45(1):150-158. PMID:17187437
  12. [ + ] Mbongo-Kama E, et al. (2007) "MDR3 mutations associated with intrahepatic and gallbladder cholesterol cholelithiasis: an update." Ann Hepatol. 6(3):143-149. PMID:17786139
  13. [ + ] Degiorgio D, et al. (2007) "Molecular characterization and structural implications of 25 new ABCB4 mutations in progressive familial intrahepatic cholestasis type 3 (PFIC3)." Eur J Hum Genet. 15(12):1230-1238. PMID:17726488
  14. [ + ] Rosmorduc O, et al. (2007) "Low phospholipid associated cholelithiasis: association with mutation in the MDR3/ABCB4 gene." Orphanet J Rare Dis. 2():29. PMID:17562004
  15. [ + ] Morita SY, et al. (2007) "Bile salt-dependent efflux of cellular phospholipids mediated by ATP binding cassette protein B4." Hepatology. 46(1):188-199. PMID:17523162
  16. [ + ] Lang C, et al. (2007) "Mutations and polymorphisms in the bile salt export pump and the multidrug resistance protein 3 associated with drug-induced liver injury." Pharmacogenet Genomics. 17(1):47-60. PMID:17264802
  17. [ + ] Wasmuth HE, et al. (2007) "Intrahepatic cholestasis of pregnancy: the severe form is associated with common variants of the hepatobiliary phospholipid transporter ABCB4 gene." Gut. 56(2):265-270. PMID:16891356
  18. [ + ] Lang T, et al. (2006) "Genetic variability, haplotype structures, and ethnic diversity of hepatic transporters MDR3 (ABCB4) and bile salt export pump (ABCB11)." Drug Metab Dispos. 34(9):1582-1599. PMID:16763017
  19. [ + ] Keitel V, et al. (2006) "Combined mutations of canalicular transporter proteins cause severe intrahepatic cholestasis of pregnancy." Gastroenterology. 131(2):624-629. PMID:16890614
  20. [ + ] Leschziner G, et al. (2006) "Clinical factors and ABCB1 polymorphisms in prediction of antiepileptic drug response: a prospective cohort study." Lancet Neurol. 5(8):668-676. PMID:16857572
  21. [ + ] Suzuki S, et al. (2006) "Protein kinase Cbeta isoform down-regulates the expression of MDR3 P-glycoprotein in human Chang liver cells." Biochim Biophys Acta. 1760(10):1552-1557. PMID:16854530
  22. [ + ] Floreani A, et al. (2006) "Intrahepatic cholestasis of pregnancy: three novel MDR3 gene mutations." Aliment Pharmacol Ther. 23(11):1649-1653. PMID:16696816
  23. [ + ] Pauli-Magnus C, et al. (2004) "Sequence analysis of bile salt export pump (ABCB11) and multidrug resistance p-glycoprotein 3 (ABCB4, MDR3) in patients with intrahepatic cholestasis of pregnancy." Pharmacogenetics. 14(2):91-102. PMID:15077010
  24. [ + ] Pauli-Magnus C, et al. (2004) "BSEP and MDR3 haplotype structure in healthy Caucasians, primary biliary cirrhosis and primary sclerosing cholangitis." Hepatology. 39(3):779-791. PMID:14999697
  25. [ + ] Ortiz DF, et al. (2004) "Identification of HAX-1 as a protein that binds bile salt export protein and regulates its abundance in the apical membrane of Madin-Darby canine kidney cells." J Biol Chem. 279(31):32761-32770. PMID:15159385
  26. [ + ] Shoda J, et al. (2004) "Bezafibrate stimulates canalicular localization of NBD-labeled PC in HepG2 cells by PPARalpha-mediated redistribution of ABCB4." J Lipid Res. 45(10):1813-1825. PMID:15258199
  27. [ + ] Huang L, et al. (2003) "Farnesoid X receptor activates transcription of the phospholipid pump MDR3." J Biol Chem. 278(51):51085-51090. PMID:14527955
  28. [ + ] Oleschuk CJ, et al. (2003) "Substitution of Trp1242 of TM17 alters substrate specificity of human multidrug resistance protein 3." Am J Physiol Gastrointest Liver Physiol. 284(2):G280-G289. PMID:12388190
  29. [ + ] Rosmorduc O, et al. (2003) "ABCB4 gene mutation-associated cholelithiasis in adults." Gastroenterology. 125(2):452-459. PMID:12891548
  30. [ + ] Hillier LW, et al. (2003) "The DNA sequence of human chromosome 7." Nature. 424(6945):157-164. PMID:12853948
  31. [ + ] Mullenbach R, et al. (2003) "ABCB4 gene sequence variation in women with intrahepatic cholestasis of pregnancy." J Med Genet. 40(5):e70. PMID:12746424
  32. [ + ] Scherer SW, et al. (2003) "Human chromosome 7: DNA sequence and biology." Science. 300(5620):767-772. PMID:12690205
  33. [ + ] Eloranta ML, et al. (2002) "Multidrug resistance 3 gene mutation 1712delT and estrogen receptor alpha gene polymorphisms in Finnish women with obstetric cholestasis." Eur J Obstet Gynecol Reprod Biol. 105(2):132-135. PMID:12381474
  34. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  35. [ + ] Eloranta ML, et al. (2002) "Multidrug resistance 3 gene mutation 1712delT and estrogen receptor alpha gene polymorphisms in Finnish women with obstetric cholestasis." Eur J Obstet Gynecol Reprod Biol. 104(2):109-112. PMID:12206920
  36. [ + ] Jacquemin E, et al. (2001) "Role of multidrug resistance 3 deficiency in pediatric and adult liver disease: one gene for three diseases." Semin Liver Dis. 21(4):551-562. PMID:11745043
  37. [ + ] Rosmorduc O, et al. (2001) "MDR3 gene defect in adults with symptomatic intrahepatic and gallbladder cholesterol cholelithiasis." Gastroenterology. 120(6):1459-1467. PMID:11313316
  38. [ + ] Dixon PH, et al. (2000) "Heterozygous MDR3 missense mutation associated with intrahepatic cholestasis of pregnancy: evidence for a defect in protein trafficking." Hum Mol Genet. 9(8):1209-1217. PMID:10767346
  39. [ + ] Jacquemin E, et al. (1999) "Heterozygous non-sense mutation of the MDR3 gene in familial intrahepatic cholestasis of pregnancy." Lancet. 353(9148):210-211. PMID:9923886
  40. [ + ] de Vree JM, et al. (1998) "Mutations in the MDR3 gene cause progressive familial intrahepatic cholestasis." Proc Natl Acad Sci U S A. 95(1):282-287. PMID:9419367
  41. [ + ] Malorni W, et al. (1998) "Intracellular expression of P-170 glycoprotein in peripheral blood mononuclear cell subsets from healthy donors and HIV-infected patients." Haematologica. 83(1):13-20. PMID:9542318
  42. [ + ] van Helvoort A, et al. (1996) "MDR1 P-glycoprotein is a lipid translocase of broad specificity, while MDR3 P-glycoprotein specifically translocates phosphatidylcholine." Cell. 87(3):507-517. PMID:8898203
  43. [ + ] Smit JJ, et al. (1995) "Characterization of the promoter region of the human MDR3 P-glycoprotein gene." Biochim Biophys Acta. 1261(1):44-56. PMID:7893760
  44. [ + ] Ruetz S, et al. (1994) "Phosphatidylcholine translocase: a physiological role for the mdr2 gene." Cell. 77(7):1071-1081. PMID:7912658
  45. [ + ] Whitington PF, et al. (1994) "Clinical and biochemical findings in progressive familial intrahepatic cholestasis." J Pediatr Gastroenterol Nutr. 18(2):134-141. PMID:7912266
  46. [ + ] Smit JJ, et al. (1994) "Tissue distribution of the human MDR3 P-glycoprotein." Lab Invest. 71(5):638-649. PMID:7734012
  47. [ + ] Smit JJ, et al. (1993) "Homozygous disruption of the murine mdr2 P-glycoprotein gene leads to a complete absence of phospholipid from bile and to liver disease." Cell. 75(3):451-462. PMID:8106172
  48. [ + ] Lincke CR, et al. (1991) "Structure of the human MDR3 gene and physical mapping of the human MDR locus." J Biol Chem. 266(8):5303-5310. PMID:2002063
  49. [ + ] van der Bliek AM, et al. (1988) "Sequence of mdr3 cDNA encoding a human P-glycoprotein." Gene. 71(2):401-411. PMID:2906314