ABCB1 | GeneID:5243 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 5243 Official Symbol ABCB1
Locus N/A Gene Type protein-coding
Synonyms ABC20; CD243; CLCS; GP170; MDR1; MGC163296; P-GP; PGY1
Full Name ATP-binding cassette, sub-family B (MDR/TAP), member 1
Description ATP-binding cassette, sub-family B (MDR/TAP), member 1
Chromosome 7q21.1
Also Known As ATP-binding cassette, subfamily B, member 1; P-glycoprotein 1; colchicin sensitivity; doxorubicin resistance; multidrug resistance protein 1
Summary The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is an ATP-dependent drug efflux pump for xenobiotic compounds with broad substrate specificity. It is responsible for decreased drug accumulation in multidrug-resistant cells and often mediates the development of resistance to anticancer drugs. This protein also functions as a transporter in the blood-brain barrier. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 55496

ID Symbol Protein Species
GeneID:5243 ABCB1 NP_000918.2 Homo sapiens
GeneID:18671 Abcb1a NP_035206.1 Mus musculus
GeneID:36582 Mdr50 NP_523740.3 Drosophila melanogaster
GeneID:170913 Abcb1 NP_596892.1 Rattus norvegicus
GeneID:178215 pgp-1 NP_502413.1 Caenorhabditis elegans
GeneID:180165 pgp-9 NP_507487.1 Caenorhabditis elegans
GeneID:281585 ABCB1 XP_590317.3 Bos taurus
GeneID:395712 ABCB1 NP_990225.1 Gallus gallus
GeneID:403879 ABCB1 NP_001003215.1 Canis lupus familiaris
GeneID:420534 ABCB4 XP_418636.2 Gallus gallus
GeneID:463516 ABCB1 XP_001163342.1 Pan troglodytes
GeneID:822463 AT3G28345 NP_189475.1 Arabidopsis thaliana
GeneID:822465 PGP16 NP_189477.1 Arabidopsis thaliana
GeneID:822467 PGP17 NP_189479.1 Arabidopsis thaliana
GeneID:822468 PGP18 NP_189480.1 Arabidopsis thaliana
GeneID:822471 AT3G28415 NP_683599.1 Arabidopsis thaliana
GeneID:2538709 pmd1 NP_588265.1 Schizosaccharomyces pombe
GeneID:2675205 MGG_00141 XP_369103.2 Magnaporthe grisea
GeneID:4328568 Os02g0190000 NP_001046147.1 Oryza sativa
GeneID:4328570 Os02g0190300 NP_001046148.1 Oryza sativa

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab3365 P Glycoprotein antibody [C494] (ab3365); Mouse monoclonal [C494] to P Glycoprotein
2 abcam ab51893 P Glycoprotein antibody [JSB-1], prediluted (ab51893); Mouse monoclonal [JSB-1] to P Glycoprotein, prediluted
3 abcam ab36743 P Glycoprotein antibody (ab36743); Rabbit polyclonal to P Glycoprotein
4 abcam ab10333 P Glycoprotein antibody [4E3] (ab10333); Mouse monoclonal [4E3] to P Glycoprotein
5 abcam ab3364 P Glycoprotein antibody [C219] (ab3364); Mouse monoclonal [C219] to P Glycoprotein
6 abcam ab3366 P Glycoprotein antibody [JSB-1] (ab3366); Mouse monoclonal [JSB-1] to P Glycoprotein
7 abcam ab66250 P Glycoprotein antibody [UIC2] (FITC) (ab66250); Mouse monoclonal [UIC2] to P Glycoprotein (FITC)
8 abcam ab60035 P Glycoprotein antibody (ab60035); Rabbit polyclonal to P Glycoprotein
9 abgent AP6111a ABCB1 Antibody (Center); Purified Rabbit Polyclonal Antibody (Pab)
10 abnova H00005243-M01 ABCB1 monoclonal antibody (M01), clone 1F11; Mouse monoclonal antibody raised against a partial recombinant ABCB1.
11 acris AM00597SU-N CD243 / MDR1; antibody Ab
12 acris AP09346PU-N CD243 / MDR1 (aa 262-277); antibody Ab
13 acris AP07094PU-N CD243 / MDR1 (Cytopl. Dom); antibody Ab
14 acris AM05632PU-N CD243 / MDR1; antibody Ab
15 acris AM05632PU-L CD243 / MDR1; antibody Ab
16 acris AP13074PU-N CD243 / MDR1 (Center); antibody Ab
17 acris AP07398PU-N CD243 / MDR1 (aa 262-277); antibody Ab
18 acris AP15701PU-N CD243 / MDR1 (C-term); antibody Ab
19 acris AM08224SU-N CD243 / MDR1; antibody Ab
20 acris AM05632FC-N CD243 / MDR1; antibody Ab
21 acris BM5058 CD243 / MDR1; antibody Ab
22 acris AM05632LE-N CD243 / MDR1; antibody Ab
23 acris AM05632RP-N CD243 / MDR1; antibody Ab
24 acris AP15701PU-S CD243 / MDR1 (C-term); antibody Ab
25 acris BM2669P CD243 / MDR1 (Ext. Epitope); antibody Ab
26 acris BM2669R CD243 / MDR1 (Ext. Epitope); antibody Ab
27 acris AM08224SU-S CD243 / MDR1; antibody Ab
28 acris AM05632BT-N CD243 / MDR1; antibody Ab
29 scbt ABCB1 ABCB1 Antibody / ABCB1 Antibodies;
30 sigma P7965 Monoclonal Anti-P-Glycoprotein (MDR) antibody produced in mouse ;

Exon, Intron and UTRs

Exon, Intron and UTRs of ABCB1 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABCB1 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0009986 Component cell surface
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0005624 Component membrane fraction
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0016787 Function hydrolase activity
GO:0000166 Function nucleotide binding
GO:0005515 Function protein binding
GO:0005215 Function transporter activity
GO:0008559 Function xenobiotic-transporting ATPase activity
GO:0042493 Process response to drug
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_000927  UCSC Browser NP_000918 A4D1D2   P08183  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000265724 MI0000063 hsa-let-7b* CUAUACAACCUACUGCCUUCCC
ENST00000265724 MI0000103 hsa-miR-101* CAGUUAUCACAGUGCUGAUGCU
ENST00000265724 MI0000472 hsa-miR-127-5p CUGAAGCUCAGAGGGCUCUGAU
ENST00000265724 MI0000477 hsa-miR-146a* CCUCUGAAAUUCAGUUCUUCAG
ENST00000265724 MI0000811 hsa-miR-148b* AAGUUCUGUUAUACACUCAGGC
ENST00000265724 MI0000272 hsa-miR-182 UUUGGCAAUGGUAGAACUCACACU
ENST00000265724 MI0000240 hsa-miR-198 GGUCCAGAGGGGAGAUAGGUUC
ENST00000265724 MI0000073 hsa-miR-19a UGUGCAAAUCUAUGCAAAACUGA
ENST00000265724 MI0000074 hsa-miR-19b UGUGCAAAUCCAUGCAAAACUGA
ENST00000265724 MI0000075 hsa-miR-19b UGUGCAAAUCCAUGCAAAACUGA
ENST00000265724 MI0000295 hsa-miR-218-2* CAUGGUUCUGUCAAGCACCGCG
ENST00000265724 MI0000254 hsa-miR-30c UGUAAACAUCCUACACUCUCAGC
ENST00000265724 MI0000736 hsa-miR-30c UGUAAACAUCCUACACUCUCAGC
ENST00000265724 MI0000812 hsa-miR-331-5p CUAGGUAUGGUCCCAGGGAUCC
ENST00000265724 MI0000814 hsa-miR-338-5p AACAAUAUCCUGGUGCUGAGUG
ENST00000265724 MI0000268 hsa-miR-34a* CAAUCAGCAAGUAUACUGCCCU
ENST00000265724 MI0000742 hsa-miR-34b* UAGGCAGUGUCAUUAGCUGAUUG
ENST00000265724 MI0000786 hsa-miR-378 ACUGGACUUGGAGUCAGAAGG
ENST00000265724 MI0001735 hsa-miR-409-3p GAAUGUUGCUCGGUGAACCCCU
ENST00000265724 MI0001729 hsa-miR-451 AAACCGUUACCAUUACUGAGUU
ENST00000265724 MI0003513 hsa-miR-455-3p GCAGUCCAUGGGCAUAUACAC
ENST00000265724 MI0003124 hsa-miR-489 GUGACAUCACAUAUACGGCAGC
ENST00000265724 MI0003126 hsa-miR-491-3p CUUAUGCAAGAUUCCCUUCUAC
ENST00000265724 MI0003127 hsa-miR-511 GUGUCUUUUGCUCUGCAGUCA
ENST00000265724 MI0003128 hsa-miR-511 GUGUCUUUUGCUCUGCAGUCA
ENST00000265724 MI0003567 hsa-miR-561 CAAAGUUUAAGAUCCUUGAAGU
ENST00000265724 MI0003620 hsa-miR-607 GUUCAAAUCCAGAUCUAUAAC
ENST00000265724 MI0005757 hsa-miR-935 CCAGUUACCGCUUCCGCUACCGC
ENST00000265724 MI0006128 mmu-miR-467e AUAAGUGUGAGCAUGUAUAUGU
ENST00000265724 MI0004644 mmu-miR-682 CUGCAGUCACAGUGAAGUCUG
ENST00000265724 MI0004694 mmu-miR-710 CCAAGUCUUGGGGAGAGUUGAG
ENST00000265724 MI0004708 mmu-miR-721 CAGUGCAAUUAAAAGGGGGAA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
1-Naphthylisothiocyanate
  • 1-Naphthylisothiocyanate results in increased expression of ABCB1 mRNA
17522070
2-Acetylaminofluorene
  • 2-Acetylaminofluorene results in increased expression of ABCB1 mRNA
  • 2-Acetylaminofluorene results in increased expression of ABCB1 protein
  • Phycocyanin inhibits the reaction [2-Acetylaminofluorene results in increased expression of ABCB1 mRNA]
  • Phycocyanin inhibits the reaction [2-Acetylaminofluorene results in increased expression of ABCB1 protein]
17303067
2-Acetylaminofluorene
  • 2-Acetylaminofluorene results in increased activity of ABCB1 protein
  • 2-Acetylaminofluorene results in increased expression of ABCB1 mRNA
  • [2-Acetylaminofluorene results in increased activity of AKT1 protein] which results in increased expression of ABCB1 mRNA
  • [2-Acetylaminofluorene results in increased activity of RAC1 protein] which results in increased expression of ABCB1 mRNA
  • [RELA protein binds to NFKB1 protein] affects the reaction [2-Acetylaminofluorene results in increased expression of ABCB1 mRNA]
11960367
2-Acetylaminofluorene
  • 2-Acetylaminofluorene results in increased expression of ABCB1 mRNA
17669244
2-Acetylaminofluorene
  • 2-Acetylaminofluorene results in decreased expression of ABCB1 mRNA
12387747
3-dinitrobenzene
  • 3-dinitrobenzene results in decreased expression of ABCB1 mRNA
16142770
6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid
  • 6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid inhibits the reaction [Vitamin A results in decreased expression of ABCB1 mRNA]
15327746
6-prenylchrysin
  • 6-prenylchrysin does not affect the activity of ABCB1 protein
15930306
8-azidoadenosine 5'-triphosphate
  • ABCB1 protein mutant form binds to 8-azidoadenosine 5'-triphosphate
  • Verapamil promotes the reaction [ABCB1 protein mutant form binds to 8-azidoadenosine 5'-triphosphate]
  • beryllium fluoride promotes the reaction [ABCB1 protein mutant form binds to 8-azidoadenosine 5'-triphosphate]
  • fluoroaluminum promotes the reaction [ABCB1 protein mutant form binds to 8-azidoadenosine 5'-triphosphate]
11027628
Acetaminophen
  • Acetaminophen promotes the reaction [ABCB1 protein results in decreased uptake of Doxorubicin]
  • Acetaminophen results in increased activity of ABCB1 protein
  • Verapamil inhibits the reaction [Acetaminophen results in increased activity of ABCB1 protein]
17526808
Acetaminophen
  • Acetaminophen results in increased expression of ABCB1 mRNA
17522070
Albendazole
  • ABCB1 protein does not affect the transport of Albendazole
15703302
albendazole sulfoxide
  • ABCB1 protein does not affect the transport of albendazole sulfoxide
15703302
Aldosterone
  • Aldosterone results in increased expression of ABCB1 mRNA
12387747
AN 204
  • AN 204 results in increased expression of ABCB1 mRNA
16051478, 16047355
AN 215
  • AN 215 results in increased expression of ABCB1 mRNA
16051478
AN 238
  • AN 238 results in increased expression of ABCB1 mRNA
16047355
Anticonvulsants
  • ABCB1 protein results in chemical resistance to Anticonvulsants
15581025
apicidin
  • ABCB1 protein results in chemical resistance to apicidin
16049968
Arsenic
  • ABCB1 protein results in increased export of Arsenic
12387749
arsenic trioxide
  • arsenic trioxide results in decreased expression of ABCB1 mRNA
15979894
arsenic trioxide
  • arsenic trioxide results in decreased expression of ABCB1 protein
15979894, 14642128
artemisinine
  • artemisinine results in decreased activity of ABCB1 protein
  • artemisinine results in increased expression of ABCB1 mRNA
15761118
artesunate
  • ABCB1 protein does not affect the response to chemical artesunate
15878303
Asbestos, Crocidolite
  • Asbestos, Crocidolite results in increased expression of ABCB1 protein
  • ferric nitrilotriacetate inhibits the reaction [Asbestos, Crocidolite results in increased expression of ABCB1 protein]
18385176
atorvastatin
  • ABCB1 protein results in increased transport of atorvastatin
  • ABCB1 protein results in increased transport of atorvastatin analog
  • atorvastatin analog inhibits the reaction [ABCB1 protein results in increased transport of calcein AM]
  • atorvastatin analog results in decreased activity of ABCB1 protein
15616150
Benzo(a)pyrene
  • Benzo(a)pyrene results in increased expression of ABCB1 mRNA
11096091
Benzo(a)pyrene
  • Benzo(a)pyrene results in increased expression of ABCB1 mRNA
15566942
benzo(k)fluoranthene
  • benzo(k)fluoranthene results in increased expression of ABCB1 mRNA
15566942
beryllium fluoride
  • beryllium fluoride promotes the reaction [ABCB1 protein mutant form binds to 8-azidoadenosine 5'-triphosphate]
11027628
Butyrates
  • Butyrates results in increased expression of ABCB1 mRNA
15711177
Butyric Acid
  • Butyric Acid results in increased expression of ABCB1 mRNA
15711177
calcein AM
  • ABCB1 protein affects the export of calcein AM
  • Cyclosporine inhibits the reaction [ABCB1 protein affects the export of calcein AM]
  • Reserpine inhibits the reaction [ABCB1 protein affects the export of calcein AM]
10617675
calcein AM
  • ABCB1 protein results in increased transport of calcein AM
  • Lovastatin analog inhibits the reaction [ABCB1 protein results in increased transport of calcein AM]
  • Pravastatin does not affect the reaction [ABCB1 protein results in increased transport of calcein AM]
  • Simvastatin analog inhibits the reaction [ABCB1 protein results in increased transport of calcein AM]
  • atorvastatin analog inhibits the reaction [ABCB1 protein results in increased transport of calcein AM]
15616150
Calcitriol
  • Calcitriol results in decreased activity of ABCB1 protein
  • Calcitriol results in increased expression of ABCB1 mRNA
12387747
Camptothecin
  • Camptothecin results in decreased expression of ABCB1 protein
10692111
Carbamazepine
  • Carbamazepine results in increased expression of ABCB1 protein
15569486
Carbamazepine
  • ABCB1 protein affects the chemical susceptibility to Carbamazepine
17376120, 14749549
Carbamazepine
  • ABCB1 protein affects the transport of Carbamazepine
17376120
Carbamazepine
  • ABCB1 protein does not affect the transport of Carbamazepine
17045309
Carbon Tetrachloride
  • Carbon Tetrachloride results in increased expression of ABCB1 mRNA
15120965
Carbon Tetrachloride
  • Carbon Tetrachloride results in increased expression of ABCB1 protein
12642476
Carbon Tetrachloride
  • Carbon Tetrachloride results in increased expression of ABCB1 mRNA
17522070
Carmustine
  • Carmustine results in increased expression of ABCB1 protein
15239124
cepharanthine
  • cepharanthine results in decreased activity of ABCB1 protein
15958061
cerivastatin
  • ABCB1 protein affects the export of cerivastatin
15901800
Chlorambucil
  • Chlorambucil results in increased expression of ABCB1 protein
15239124
chlorcyclizine
  • ABCB1 protein affects the transport of chlorcyclizine
15666293
Chloroform
  • Chloroform results in increased expression of ABCB1 mRNA
17522070
Chloroform
  • Chloroform results in increased expression of ABCB1 mRNA
15120965
Chlorpheniramine
  • ABCB1 protein affects the transport of Chlorpheniramine
15666293
Chlorpyrifos
  • ABCB1 protein does not affect the export of Chlorpyrifos
  • Chlorpyrifos binds to ABCB1 protein
  • Chlorpyrifos inhibits the reaction [ABCB1 protein results in increased export of Doxorubicin]
8917702
chrysene
  • chrysene results in increased expression of ABCB1 mRNA
15566942
Cimetidine
  • Cimetidine does not affect the expression of ABCB1 mRNA
12387747
Cisplatin
  • ABCB1 protein results in chemical resistance to Cisplatin
15990222
Cisplatin
  • ABCB1 protein results in chemical resistance to Cisplatin
11455017
Cisplatin
  • Cisplatin results in increased expression of ABCB1 mRNA
15650019
Cisplatin
  • ABCB1 protein does not affect the response to chemical Cisplatin
15802814
Cisplatin
  • Cisplatin results in increased expression of ABCB1 protein
15990222, 15239124, 15650019
Cisplatin
  • ABCB1 affects the chemical susceptibility to Cisplatin
15756446
CJX1 cpd
  • CJX1 cpd inhibits the reaction [ABCB1 protein results in decreased secretion of Doxorubicin]
  • CJX1 cpd results in decreased activity of ABCB1 protein
15967469
CJY compound
  • CJY compound results in decreased activity of ABCB1 protein
17637197
Clotrimazole
  • Clotrimazole does not affect the expression of ABCB1 mRNA
15914091
Clotrimazole
  • ABCB1 protein does not affect the export of Clotrimazole
  • Clotrimazole binds to ABCB1 protein
  • Clotrimazole inhibits the reaction [ABCB1 protein results in increased export of Doxorubicin]
8917702
Clotrimazole
  • Clotrimazole results in increased expression of ABCB1 protein
8632764
Colchicine
  • ABCB1 protein results in chemical resistance to Colchicine
15725475
Colchicine
  • Colchicine results in increased expression of ABCB1 mRNA
15342794
Colchicine
  • Sesquiterpenes analog inhibits the reaction [ABCB1 protein affects the transport of Colchicine]
15466210
Colchicine
  • ABCB1 protein affects the transport of Colchicine
16007523
Curcumin
  • Curcumin does not affect the folding of ABCB1 protein mutant form
  • Curcumin does not affect the localization of ABCB1 protein mutant form
15530432
Cyclophosphamide
  • ABCB1 protein affects the chemical susceptibility to [Cyclophosphamide co-treated with Methotrexate co-treated with Fluorouracil]
  • ABCB1 protein affects the chemical susceptibility to [Fluorouracil co-treated with Epirubicin co-treated with Cyclophosphamide]
12576456
Cyclosporine
  • [Thioacetamide co-treated with Cyclosporine] results in increased expression of ABCB1 mRNA
15770714
Cyclosporine
  • ABCB1 protein affects the chemical susceptibility to Cyclosporine
  • Cyclosporine results in increased expression of ABCB1 mRNA
12387747
Cyclosporine
  • Cyclosporine results in decreased activity of ABCB1 protein
18408562, 12387747
Cyclosporine
  • Cyclosporine results in decreased expression of ABCB1 mRNA
  • Cyclosporine results in decreased expression of ABCB1 protein
  • [Cyclosporine co-treated with Raloxifene] results in decreased expression of ABCB1 mRNA
  • [Cyclosporine co-treated with Raloxifene] results in decreased expression of ABCB1 protein
17096884
Cyclosporine
  • Cyclosporine inhibits the reaction [ABCB1 protein results in increased export of Diazinon]
16221533
Cyclosporine
  • Cyclosporine affects the folding of and affects the localization of ABCB1 protein mutant form
15530432
Cyclosporine
  • ABCB1 protein polymorphism affects the chemical susceptibility to Cyclosporine
15772250
Cyclosporine
  • Cyclosporine inhibits the reaction [ABCB1 protein results in increased export of Daunorubicin]
12526924
Cyclosporine
  • Cyclosporine results in decreased activity of ABCB1 protein
15744065
Cyclosporine
  • Cyclosporine inhibits the reaction [ABCB1 protein affects the export of calcein AM]
10617675
Cyclosporine
  • Cyclosporine inhibits the reaction [ABCB1 protein results in chemical resistance to Doxorubicin]
  • Cyclosporine inhibits the reaction [ABCB1 protein results in decreased uptake of Doxorubicin]
17947497
Cyclosporine
  • ABCB1 protein affects the export of Cyclosporine
15964336
Cyclosporine
  • ABCB1 protein affects the transport of Cyclosporine
15964407
Cyclosporine
  • ABCB1 protein results in increased transport of Cyclosporine
17045309
Cyclosporins
  • Cyclosporins affects the activity of ABCB1 protein
15788683
Cytarabine
  • ABCB1 protein affects the chemical susceptibility to Cytarabine
17852453
Dactinomycin
  • ABCB1 protein results in chemical resistance to Dactinomycin
11455017
Dactinomycin
  • ABCB1 protein results in chemical resistance to Dactinomycin
15725475
Daunorubicin
  • ABCB1 protein affects the transport of Daunorubicin
12642476
Daunorubicin
  • ABCB1 protein results in increased export of Daunorubicin
  • Cyclosporine inhibits the reaction [ABCB1 protein results in increased export of Daunorubicin]
  • [Sodium Azide co-treated with Iodoacetates] inhibits the reaction [ABCB1 protein results in increased export of Daunorubicin]
12526924
Daunorubicin
  • Sesquiterpenes analog inhibits the reaction [ABCB1 protein results in chemical resistance to Daunorubicin]
15466210
Daunorubicin
  • ABCB1 protein results in decreased uptake of Daunorubicin
10617675
DDT
  • DDT results in increased expression of ABCB1 mRNA
15710169
Deoxyglucose
  • Deoxyglucose inhibits the reaction [ABCB1 protein results in increased export of Diazinon]
16221533
Dexamethasone
  • Dexamethasone results in increased expression of ABCB1 protein
17015168
Dexamethasone
  • Dexamethasone results in decreased activity of ABCB1 protein
  • Dexamethasone results in increased expression of ABCB1 mRNA
12387747
Diazinon
  • ABCB1 protein results in increased export of Diazinon
  • Cyclosporine inhibits the reaction [ABCB1 protein results in increased export of Diazinon]
  • Deoxyglucose inhibits the reaction [ABCB1 protein results in increased export of Diazinon]
  • Diazinon affects the reaction [ABCB1 protein results in increased transport of Digoxin]
  • Diazinon affects the reaction [ABCB1 protein results in increased transport of Vinblastine]
  • Diazinon results in increased activity of ABCB1 protein
  • Diazinon results in increased expression of ABCB1 protein
  • Sodium Azide inhibits the reaction [ABCB1 protein results in increased export of Diazinon]
  • valspodar inhibits the reaction [ABCB1 protein results in increased export of Diazinon]
  • verlukast does not affect the reaction [ABCB1 protein results in increased export of Diazinon]
  • Diazinon results in increased expression of ABCB1 mRNA
  • Diazinon results in increased expression of ABCB1 protein
16221533
dibenzo(a,l)pyrene
  • dibenzo(a,l)pyrene results in increased expression of ABCB1 mRNA
15566942
Dichlorodiphenyl Dichloroethylene
  • Dichlorodiphenyl Dichloroethylene results in decreased expression of ABCB1 mRNA
  • Dichlorodiphenyl Dichloroethylene results in increased expression of ABCB1 mRNA
15710169
Diethylhexyl Phthalate
  • Diethylhexyl Phthalate promotes the reaction [NR1I2 protein results in increased expression of ABCB1 mRNA]
  • Diethylhexyl Phthalate results in increased expression of ABCB1 mRNA
17003290
Diethylstilbestrol
  • Diethylstilbestrol results in decreased expression of ABCB1 protein
16925584
Digoxin
  • ABCB1 protein affects the transport of Digoxin
  • Itraconazole inhibits the reaction [ABCB1 protein affects the transport of Digoxin]
  • Ketoconazole inhibits the reaction [ABCB1 protein affects the transport of Digoxin]
15969931
Digoxin
  • ABCB1 protein results in increased transport of Digoxin
  • Diazinon affects the reaction [ABCB1 protein results in increased transport of Digoxin]
16221533
Digoxin
  • ABCB1 protein results in decreased uptake of Digoxin
10617675
Digoxin
  • ABCB1 protein binds to and affects the metabolism of Digoxin
15856409
Dimethylnitrosamine
  • Dimethylnitrosamine results in increased expression of ABCB1 mRNA
17072980
Dimethyl Sulfoxide
  • Dimethyl Sulfoxide affects the expression of ABCB1 mRNA
12843640
docetaxel
  • docetaxel results in increased expression of ABCB1 mRNA
  • docetaxel results in increased expression of ABCB1 protein
15239124
docetaxel
  • ABCB1 mRNA results in chemical sensitivity to docetaxel
15239142
Doxorubicin
  • pluronic block copolymer p85 inhibits the reaction [Doxorubicin results in increased expression of ABCB1 protein]
16579640
Doxorubicin
  • ABCB1 protein results in increased secretion of Doxorubicin
  • Doxorubicin affects the activity of ABCB1 protein
  • Tamoxifen affects the reaction [ABCB1 protein results in increased secretion of Doxorubicin]
  • Tamoxifen inhibits the reaction [Doxorubicin affects the activity of ABCB1 protein]
15937726
Doxorubicin
  • ABCB1 protein results in chemical resistance to Doxorubicin
11455017
Doxorubicin
  • Chlorpyrifos inhibits the reaction [ABCB1 protein results in increased export of Doxorubicin]
  • Clotrimazole inhibits the reaction [ABCB1 protein results in increased export of Doxorubicin]
  • Endosulfan inhibits the reaction [ABCB1 protein results in increased export of Doxorubicin]
  • Ivermectin inhibits the reaction [ABCB1 protein results in increased export of Doxorubicin]
  • Parathion inhibits the reaction [ABCB1 protein results in increased export of Doxorubicin]
  • Verapamil inhibits the reaction [ABCB1 protein results in increased export of Doxorubicin]
  • hydramethylnon inhibits the reaction [ABCB1 protein results in increased export of Doxorubicin]
8917702
Doxorubicin
  • Doxorubicin results in increased activity of ABCB1 protein
17526808, 15501994
Doxorubicin
  • [[Tretinoin co-treated with romidepsin] results in increased expression of ABCB1 mRNA] which results in chemical resistance to Doxorubicin
  • valspodar inhibits the reaction [[[Tretinoin co-treated with romidepsin] results in increased expression of ABCB1 mRNA] which results in chemical resistance to Doxorubicin]
16223781
Doxorubicin
  • Haloperidol inhibits the reaction [ABCB1 protein results in chemical resistance to Doxorubicin]
15946544
Doxorubicin
  • ABCB1 protein results in chemical resistance to Doxorubicin
8917702, 11313874, 15861398, 15765123, 11355955, 15725475, 17947497
Doxorubicin
  • meloxicam inhibits the reaction [Doxorubicin results in increased activity of ABCB1 protein]
  • meloxicam inhibits the reaction [Doxorubicin results in increased expression of ABCB1 protein]
15501994
Doxorubicin
  • Acetaminophen promotes the reaction [ABCB1 protein results in decreased uptake of Doxorubicin]
  • Verapamil inhibits the reaction [Doxorubicin results in increased activity of ABCB1 protein]
17526808
Doxorubicin
  • ABCB1 promoter modified form results in chemical resistance to Doxorubicin
16356834
Doxorubicin
  • ABCB1 protein results in decreased uptake of Doxorubicin
  • Verapamil inhibits the reaction [ABCB1 protein results in decreased uptake of Doxorubicin]
17947497, 17526808
Doxorubicin
  • Doxorubicin results in increased expression of ABCB1 mRNA
18560228, 18510171, 16544145, 17852453
Doxorubicin
  • Doxorubicin results in increased expression of ABCB1 mRNA
  • [Doxorubicin co-treated with polyisohexylcyanoacrylate] results in increased expression of ABCB1 mRNA
15826724
Doxorubicin
  • ABCB1 protein affects the chemical susceptibility to Doxorubicin
17085340
Doxorubicin
  • ABCB1 protein results in decreased secretion of Doxorubicin
  • CJX1 cpd inhibits the reaction [ABCB1 protein results in decreased secretion of Doxorubicin]
15967469
Doxorubicin
  • ABCB1 protein results in decreased abundance of Doxorubicin
  • [Verapamil results in decreased expression of ABCB1] promotes the reaction [Doxorubicin results in increased activity of CASP3 protein]
  • [Verapamil results in decreased expression of ABCB1] promotes the reaction [Doxorubicin results in increased activity of CASP7 protein]
15861398
Doxorubicin
  • ABCB1 protein results in increased export of Doxorubicin
8917702, 17483874
Doxorubicin
  • Doxorubicin results in increased expression of ABCB1 protein
16579640, 15501994
Doxorubicin
  • ABCB1 mRNA results in chemical sensitivity to Doxorubicin
15239142
Doxorubicin
  • ABCB1 protein results in chemical resistance to Doxorubicin
15906164
Doxorubicin
  • ABCB1 protein results in increased transport of and affects the chemical susceptibility to Doxorubicin
18461970
Doxorubicin
  • terameprocol inhibits the reaction [Doxorubicin results in increased expression of ABCB1 mRNA]
16544145
Doxorubicin
  • ABCB1 protein affects the transport of Doxorubicin
16499877
Doxorubicin
  • ABCB1 mRNA results in chemical resistance to Doxorubicin
16322897, 16044152, 15765123
Doxorubicin
  • Doxorubicin results in increased expression of ABCB1
15736412
Doxorubicin
  • valspodar inhibits the reaction [ABCB1 protein results in chemical resistance to Doxorubicin]
15492788
Doxorubicin
  • Cyclosporine inhibits the reaction [ABCB1 protein results in chemical resistance to Doxorubicin]
  • Cyclosporine inhibits the reaction [ABCB1 protein results in decreased uptake of Doxorubicin]
  • Verapamil inhibits the reaction [ABCB1 protein results in chemical resistance to Doxorubicin]
  • valspodar inhibits the reaction [ABCB1 protein results in chemical resistance to Doxorubicin]
  • valspodar inhibits the reaction [ABCB1 protein results in decreased uptake of Doxorubicin]
17947497
Doxycycline
  • Doxycycline results in decreased expression of ABCB1 protein
11147995
Endosulfan
  • ABCB1 protein results in chemical resistance to Endosulfan
  • ABCB1 protein results in increased export of Endosulfan
  • Endosulfan binds to ABCB1 protein
  • Endosulfan inhibits the reaction [ABCB1 protein results in increased export of Doxorubicin]
8917702
Endotoxins
  • Endotoxins results in decreased expression of ABCB1 protein
15740733
Epirubicin
  • ABCB1 protein affects the chemical susceptibility to [Fluorouracil co-treated with Epirubicin co-treated with Cyclophosphamide]
12576456
Erythromycin
  • ABCB1 protein affects the transport of Erythromycin
15304119
Erythromycin Estolate
  • Erythromycin Estolate results in increased expression of ABCB1 mRNA
17522070
Estradiol
  • ESR1 protein affects the reaction [Estradiol results in decreased expression of ABCB1 protein]
  • Estradiol does not affect the expression of ABCB1 mRNA
  • Tamoxifen inhibits the reaction [Estradiol results in decreased expression of ABCB1 protein]
  • [Estradiol results in decreased expression of ABCB1 protein] which results in increased uptake of and results in chemical sensitivity to Vincristine
16925584
Estrone
  • Estrone results in decreased expression of ABCB1 protein
16925584
etiracetam
  • ABCB1 protein does not affect the transport of etiracetam
17045309
etiracetam
  • etiracetam results in decreased activity of ABCB1 protein
18408562
Etoposide
  • ABCB1 exon polymorphism affects the chemical susceptibility to Etoposide
12969965
Etoposide
  • Etoposide results in increased expression of ABCB1 protein
15239124
evodiamine
  • evodiamine inhibits the reaction [TNF protein results in increased expression of ABCB1 protein]
15710601
Fenbendazole
  • ABCB1 protein does not affect the transport of Fenbendazole
15703302
ferric nitrilotriacetate
  • ferric nitrilotriacetate inhibits the reaction [Asbestos, Crocidolite results in increased expression of ABCB1 protein]
  • ferric nitrilotriacetate inhibits the reaction [Razoxane results in increased expression of ABCB1 protein]
18385176
fluoroaluminum
  • fluoroaluminum promotes the reaction [ABCB1 protein mutant form binds to 8-azidoadenosine 5'-triphosphate]
11027628
Fluorouracil
  • ABCB1 protein affects the chemical susceptibility to [Cyclophosphamide co-treated with Methotrexate co-treated with Fluorouracil]
  • ABCB1 protein affects the chemical susceptibility to [Fluorouracil co-treated with Epirubicin co-treated with Cyclophosphamide]
12576456
Fluorouracil
  • Fluorouracil results in increased expression of ABCB1 protein
15239124
Forskolin
  • Forskolin results in increased expression of ABCB1 mRNA
  • H 89 inhibits the reaction [Forskolin results in increased expression of ABCB1 mRNA]
12926078
gabapentin
  • gabapentin results in decreased activity of ABCB1 protein
18408562
GF 120918
  • GF 120918 results in decreased activity of ABCB1 protein
15832500
GF 120918
  • GF 120918 results in decreased activity of ABCB1 protein
15860656
H 89
  • H 89 inhibits the reaction [Forskolin results in increased expression of ABCB1 mRNA]
12926078
Haloperidol
  • Haloperidol inhibits the reaction [ABCB1 protein results in chemical resistance to Doxorubicin]
  • Haloperidol results in decreased expression of ABCB1 mRNA
15946544
hydramethylnon
  • ABCB1 protein does not affect the export of hydramethylnon
  • hydramethylnon binds to ABCB1 protein
  • hydramethylnon inhibits the reaction [ABCB1 protein results in increased export of Doxorubicin]
8917702
hyperforin
  • hyperforin results in increased expression of ABCB1
16005588
hypericin
  • hypericin results in increased expression of ABCB1
16005588
imatinib
  • imatinib results in increased expression of ABCB1 mRNA
  • imatinib results in increased expression of and results in increased activity of ABCB1 protein
15970668
indole-3-carbinol
  • indole-3-carbinol results in decreased expression of ABCB1
16082211
Iodoacetates
  • [Sodium Azide co-treated with Iodoacetates] inhibits the reaction [ABCB1 protein results in increased export of Daunorubicin]
12526924
irinotecan
  • ABCB1 protein results in increased export of irinotecan
16271446
irinotecan
  • ABCB1 protein results in chemical resistance to irinotecan
16815871
irinotecan
  • ABCB1 exon SNP affects the chemical susceptibility to and affects the metabolism of irinotecan
15801936
irinotecan
  • ABCB1 gene polymorphism affects the chemical susceptibility to irinotecan
12960109
irinotecan
  • ABCB1 protein does not affect the secretion of irinotecan analog
16003561
irinotecan
  • ABCB1 protein affects the export of irinotecan
15655543
isosafrole
  • isosafrole results in increased expression of ABCB1 protein
8632764
Itraconazole
  • Itraconazole results in decreased activity of ABCB1 protein
15969931, 15905803
Itraconazole
  • Itraconazole inhibits the reaction [ABCB1 protein affects the transport of Digoxin]
15969931
Itraconazole
  • ABCB1 protein affects the transport of Itraconazole
15905803
Itraconazole
  • Itraconazole affects the activity of ABCB1 protein
15964336
Ivermectin
  • ABCB1 protein does not affect the export of Ivermectin
  • Ivermectin binds to ABCB1 protein
  • Ivermectin inhibits the reaction [ABCB1 protein results in increased export of Doxorubicin]
8917702
kavain
  • kavain results in increased activity of ABCB1 protein
16033948
Ketoconazole
  • Ketoconazole inhibits the reaction [ABCB1 protein affects the transport of Digoxin]
  • Ketoconazole results in decreased activity of ABCB1 protein
15969931
KT 5720
  • KT 5720 results in decreased activity of ABCB1 protein
15725475
lamotrigine
  • lamotrigine results in decreased activity of ABCB1 protein
18408562
Lomustine
  • Lomustine results in increased expression of ABCB1 protein
15239124
Lovastatin
  • ABCB1 protein results in increased transport of Lovastatin
  • ABCB1 protein results in increased transport of Lovastatin analog
  • Lovastatin analog inhibits the reaction [ABCB1 protein results in increased transport of calcein AM]
  • Lovastatin analog results in decreased activity of ABCB1 protein
15616150
Luteolin
  • Luteolin does not affect the expression of ABCB1 protein
18503759
Mannitol
  • Mannitol inhibits the reaction [Vitamin A results in decreased expression of ABCB1 mRNA]
15327746
meloxicam
  • meloxicam inhibits the reaction [Doxorubicin results in increased activity of ABCB1 protein]
  • meloxicam inhibits the reaction [Doxorubicin results in increased expression of ABCB1 protein]
15501994
Methotrexate
  • Methotrexate results in increased expression of ABCB1 protein
15239124
Methotrexate
  • ABCB1 protein affects the chemical susceptibility to [Cyclophosphamide co-treated with Methotrexate co-treated with Fluorouracil]
12576456
Methylcholanthrene
  • Methylcholanthrene results in increased expression of ABCB1 mRNA
11096091
micafungin
  • micafungin does not affect the activity of ABCB1 protein
15969931
Midazolam
  • Midazolam results in increased expression of ABCB1 protein
8632764
miltefosine
  • ABCB1 protein results in chemical resistance to miltefosine
  • miltefosine binds to and results in decreased activity of ABCB1 protein
11355955
Mitoxantrone
  • Mitoxantrone results in increased expression of ABCB1 protein
15239124
Naloxone
  • Naloxone results in increased expression of ABCB1 mRNA
17522070
Nelfinavir
  • ABCB1 gene SNP affects the chemical susceptibility to Nelfinavir
  • ABCB1 intron SNP affects the chemical susceptibility to Nelfinavir
  • ABCB1 protein affects the transport of Nelfinavir
16041239
Nifedipine
  • Nifedipine does not affect the expression of ABCB1 mRNA
15914091
Nifedipine
  • Nifedipine results in increased expression of ABCB1 protein
8632764
NK 104
  • ABCB1 protein affects the transport of NK 104
15955871
oxfendazole
  • ABCB1 protein does not affect the transport of oxfendazole
15703302
Paclitaxel
  • Paclitaxel results in increased expression of ABCB1 mRNA
15650019
Paclitaxel
  • ABCB1 protein results in chemical resistance to Paclitaxel
15990222, 15252144
Paclitaxel
  • ABCB1 mRNA results in chemical resistance to Paclitaxel
16322897
Paclitaxel
  • ABCB1 gene polymorphism affects the metabolism of Paclitaxel
15901749
Paclitaxel
  • Paclitaxel results in increased expression of ABCB1 protein
15990222, 15650019
Paclitaxel
  • ABCB1 mRNA results in chemical sensitivity to Paclitaxel
15239142
Paclitaxel
  • ABCB1 protein results in decreased uptake of Paclitaxel
10617675
Parathion
  • ABCB1 protein results in decreased export of Parathion
  • Parathion binds to ABCB1 protein
  • Parathion inhibits the reaction [ABCB1 protein results in increased export of Doxorubicin]
8917702
Phalloidine
  • Phalloidine results in decreased localization of ABCB1 protein
12169763
phenethyl isothiocyanate
  • ABCB1 protein does not affect the transport of phenethyl isothiocyanate
16002050
Phenobarbital
  • Phenobarbital results in increased expression of ABCB1 protein
8632764
Phenobarbital
  • Phenobarbital does not affect the expression of ABCB1 protein
12231384
Phenobarbital
  • Phenobarbital results in decreased activity of ABCB1 protein
18408562
Phenobarbital
  • Phenobarbital results in increased expression of ABCB1 protein
15569486
Phenytoin
  • Phenytoin results in decreased activity of ABCB1 protein
18408562
Phenytoin
  • ABCB1 protein affects the chemical susceptibility to Phenytoin
17529887, 17376120, 14749549
Phenytoin
  • ABCB1 protein does not affect the transport of Phenytoin
17045309
Phenytoin
  • Phenytoin does not affect the expression of ABCB1 protein
12231384
Phenytoin
  • ABCB1 protein results in increased metabolism of Phenytoin
16220110
Phenytoin
  • Phenytoin results in increased expression of ABCB1 protein
15569486
Phenytoin
  • ABCB1 protein affects the abundance of Phenytoin
8001500, 10580886
Phosphatidylcholines
  • ABCB1 protein affects the transport of Phosphatidylcholines
11745043
Phosphatidylcholines
  • ABCB1 protein affects the export of Phosphatidylcholines
11147995
Phycocyanin
  • Phycocyanin inhibits the reaction [2-Acetylaminofluorene results in increased expression of ABCB1 mRNA]
  • Phycocyanin inhibits the reaction [2-Acetylaminofluorene results in increased expression of ABCB1 protein]
17303067
PKC412
  • PKC412 results in decreased activity of ABCB1 protein
11836167
Plant Extracts
  • Plant Extracts results in increased activity of ABCB1 protein
16033948
Plant Extracts
  • Plant Extracts results in decreased activity of ABCB1 protein
15627040
Plant Extracts
  • Plant Extracts does not affect the expression of ABCB1 mRNA
15729621
plastochromanol 8
  • plastochromanol 8 does not affect the expression of ABCB1
  • plastochromanol 8 results in increased expression of ABCB1
15269186
pluronic block copolymer p85
  • pluronic block copolymer p85 inhibits the reaction [Doxorubicin results in increased expression of ABCB1 protein]
16579640
pluronic block copolymer p85
  • pluronic block copolymer p85 results in decreased folding of and results in decreased activity of ABCB1 protein
15648254
polyisohexylcyanoacrylate
  • [Doxorubicin co-treated with polyisohexylcyanoacrylate] results in increased expression of ABCB1 mRNA
15826724
Pravastatin
  • ABCB1 protein results in increased transport of Pravastatin
  • ABCB1 protein results in increased transport of Pravastatin analog
  • Pravastatin does not affect the reaction [ABCB1 protein results in increased transport of calcein AM]
15616150
Prazosin
  • ABCB1 protein affects the transport of Prazosin
15616150
Pregnenolone Carbonitrile
  • Pregnenolone Carbonitrile results in increased expression of ABCB1 mRNA
15914091
prulifloxacin
  • ABCB1 protein affects the transport of prulifloxacin metabolite
15618759
Quercetin
  • Quercetin results in decreased expression of ABCB1
16059641
Quercetin
  • Quercetin results in decreased expression of ABCB1 mRNA
  • Quercetin results in decreased expression of ABCB1 protein
18283591
Quinidine
  • ABCB1 protein affects the transport of Quinidine
15616150
Quinidine
  • Quinidine results in decreased activity of ABCB1 protein
15666293
quinidinium
  • ABCB1 protein affects the uptake of quinidinium
11934808
Quinine
  • ABCB1 protein affects the uptake of Quinine analog
11934808
Raloxifene
  • ABCB1 protein affects the activity of Raloxifene
16959878
Raloxifene
  • Raloxifene results in decreased expression of ABCB1 mRNA
  • Raloxifene results in decreased expression of ABCB1 protein
  • [Cyclosporine co-treated with Raloxifene] results in decreased expression of ABCB1 mRNA
  • [Cyclosporine co-treated with Raloxifene] results in decreased expression of ABCB1 protein
17096884
Razoxane
  • Razoxane results in increased expression of ABCB1 protein
  • ferric nitrilotriacetate inhibits the reaction [Razoxane results in increased expression of ABCB1 protein]
18385176
Reserpine
  • Reserpine results in increased expression of ABCB1 protein
8632764
Reserpine
  • Reserpine inhibits the reaction [ABCB1 protein affects the export of calcein AM]
10617675
Rifampin
  • Rifampin affects the activity of ABCB1 protein
15964336
Rifampin
  • Rifampin results in increased expression of ABCB1 protein
8632764
Rifampin
  • Rifampin results in increased expression of ABCB1 mRNA
17003290, 14722322, 15710169
Risperidone
  • ABCB1 protein polymorphism does not affect the response to chemical Risperidone
15669884
romidepsin
  • romidepsin results in increased expression of ABCB1 mRNA
16223781, 15833893
romidepsin
  • ABCB1 protein results in chemical resistance to romidepsin
16049968
romidepsin
  • Tretinoin promotes the reaction [romidepsin results in increased acetylation of ABCB1 promoter]
  • [Tretinoin co-treated with romidepsin] results in increased expression of ABCB1 protein
  • [[Tretinoin co-treated with romidepsin] results in increased expression of ABCB1 mRNA] which results in chemical resistance to Doxorubicin
  • romidepsin promotes the reaction [Tretinoin results in increased expression of ABCB1 mRNA]
  • romidepsin results in increased acetylation of ABCB1 promoter
  • valspodar inhibits the reaction [[[Tretinoin co-treated with romidepsin] results in increased expression of ABCB1 mRNA] which results in chemical resistance to Doxorubicin]
16223781
romidepsin
  • romidepsin results in increased expression of ABCB1 protein
15833893, 15634944
romidepsin
  • ABCB1 protein binds to and affects the export of romidepsin
15634944
Saquinavir
  • ABCB1 protein affects the export of Saquinavir
15832500
SB T-1214
  • SB T-1214 does not affect the activity of ABCB1 protein
16059735
Sesquiterpenes
  • Sesquiterpenes analog binds to and affects the activity of ABCB1 protein
  • Sesquiterpenes analog inhibits the reaction [ABCB1 protein affects the transport of Colchicine]
  • Sesquiterpenes analog inhibits the reaction [ABCB1 protein affects the transport of tetramethylrosamine]
  • Sesquiterpenes analog inhibits the reaction [ABCB1 protein results in chemical resistance to Daunorubicin]
  • Sesquiterpenes analog inhibits the reaction [ABCB1 protein results in chemical resistance to Vinblastine]
15466210
Simvastatin
  • ABCB1 protein does not affect the transport of Simvastatin analog
  • ABCB1 protein results in increased transport of Simvastatin
  • Simvastatin analog inhibits the reaction [ABCB1 protein results in increased transport of calcein AM]
  • Simvastatin analog results in decreased activity of ABCB1 protein
15616150
Sirolimus
  • ABCB1 protein affects the metabolism of Sirolimus
15760093, 15707415
Sirolimus
  • ABCB1 protein affects the transport of Sirolimus
15964407
sitosterol
  • ABCB1 protein does not affect the transport of sitosterol
12488046
sodium arsenite
  • sodium arsenite results in increased expression of ABCB1 mRNA
11455017, 11408547
sodium arsenite
  • ABCB1 protein results in chemical resistance to sodium arsenite
  • sodium arsenite results in increased expression of ABCB1 protein
11455017
sodium arsenite
  • sodium arsenite results in increased expression of ABCB1 mRNA
15694464
Sodium Azide
  • Sodium Azide inhibits the reaction [ABCB1 protein results in increased export of Diazinon]
16221533
Sodium Azide
  • [Sodium Azide co-treated with Iodoacetates] inhibits the reaction [ABCB1 protein results in increased export of Daunorubicin]
12526924
Tacrolimus
  • ABCB1 gene polymorphism does not affect the response to chemical Tacrolimus
15919447
Tacrolimus
  • ABCB1 protein affects the export of Tacrolimus
15964336, 15919446
Tacrolimus
  • ABCB1 protein affects the chemical susceptibility to Tacrolimus
15919446
Tamoxifen
  • Tamoxifen inhibits the reaction [Estradiol results in decreased expression of ABCB1 protein]
16925584
Tamoxifen
  • Tamoxifen affects the reaction [ABCB1 protein results in increased secretion of Doxorubicin]
  • Tamoxifen inhibits the reaction [Doxorubicin affects the activity of ABCB1 protein]
15937726
tariquidar
  • tariquidar results in decreased activity of ABCB1 protein
15494300
Taurocholic Acid
  • Taurocholic Acid results in increased expression of ABCB1 protein
11113123
Taurocholic Acid
  • Taurocholic Acid does not affect the expression of ABCB1 protein
12644037
tauromuricholic acid
  • tauromuricholic acid does not affect the expression of ABCB1 protein
12644037
tauroursodeoxycholic acid
  • tauroursodeoxycholic acid does not affect the expression of ABCB1 protein
12644037
taxane
  • taxane analog affects the activity of ABCB1 protein
15771464
tectochrysin
  • tectochrysin does not affect the activity of ABCB1 protein
15930306
terameprocol
  • terameprocol inhibits the reaction [Doxorubicin results in increased expression of ABCB1 mRNA]
  • terameprocol inhibits the reaction [SP1 protein results in increased expression of ABCB1 mRNA]
  • terameprocol results in decreased expression of ABCB1 mRNA
16544145
Tetrachlorodibenzodioxin
  • Tetrachlorodibenzodioxin does not affect the expression of ABCB1 mRNA
11096091
Tetracycline
  • Tetracycline results in increased expression of ABCB1 mRNA
17522070
tetramethylrosamine
  • Sesquiterpenes analog inhibits the reaction [ABCB1 protein affects the transport of tetramethylrosamine]
15466210
Thalidomide
  • Thalidomide does not affect the activity of ABCB1 protein
  • Thalidomide does not affect the expression of ABCB1 mRNA
16136308
Thalidomide
  • Thalidomide results in decreased expression of ABCB1 mRNA
15920492
Thapsigargin
  • Thapsigargin does not affect the folding of ABCB1 protein mutant form
  • Thapsigargin does not affect the localization of ABCB1 protein mutant form
15530432
thiazolyl blue
  • thiazolyl blue results in decreased activity of ABCB1 protein
15451006
Thioacetamide
  • [Thioacetamide co-treated with Cyclosporine] results in increased expression of ABCB1 mRNA
15770714
tipifarnib
  • ABCB1 gene SNP affects the chemical susceptibility to tipifarnib
15122075
tocotrienol, alpha
  • tocotrienol, alpha does not affect the expression of ABCB1
  • tocotrienol, alpha results in increased expression of ABCB1
15269186
tocotrienol, beta
  • tocotrienol, beta does not affect the expression of ABCB1
  • tocotrienol, beta results in increased expression of ABCB1
15269186
tocotrienol, delta
  • tocotrienol, delta does not affect the expression of ABCB1
  • tocotrienol, delta results in increased expression of ABCB1
15269186
Tretinoin
  • Tretinoin promotes the reaction [romidepsin results in increased acetylation of ABCB1 promoter]
  • Tretinoin results in increased acetylation of ABCB1 promoter
  • Tretinoin results in increased expression of ABCB1 mRNA
  • [Tretinoin co-treated with romidepsin] results in increased expression of ABCB1 protein
  • [[Tretinoin co-treated with romidepsin] results in increased expression of ABCB1 mRNA] which results in chemical resistance to Doxorubicin
  • romidepsin promotes the reaction [Tretinoin results in increased expression of ABCB1 mRNA]
  • valspodar inhibits the reaction [[[Tretinoin co-treated with romidepsin] results in increased expression of ABCB1 mRNA] which results in chemical resistance to Doxorubicin]
16223781
Trichloroethylene
  • Trichloroethylene results in increased expression of ABCB1 mRNA
17905399
Trimethoprim
  • Trimethoprim does not affect the expression of ABCB1 mRNA
12387747
tryptanthrine
  • tryptanthrine binds to ABCB1 promoter
  • tryptanthrine results in decreased expression of ABCB1 mRNA
  • tryptanthrine results in decreased expression of ABCB1 protein
17482571
U 0126
  • U 0126 results in decreased expression of ABCB1 mRNA
  • U 0126 results in decreased expression of ABCB1 protein
15526378
Valproic Acid
  • Valproic Acid results in decreased activity of ABCB1 protein
18408562
Valproic Acid
  • ABCB1 protein affects the chemical susceptibility to Valproic Acid
14749549
Valproic Acid
  • Valproic Acid results in increased expression of ABCB1 protein
15569486
valspodar
  • valspodar results in decreased activity of ABCB1 protein
17097285, 12387749, 11455017, 15456083
valspodar
  • valspodar inhibits the reaction [ABCB1 protein results in chemical resistance to Doxorubicin]
15492788
valspodar
  • valspodar inhibits the reaction [[[Tretinoin co-treated with romidepsin] results in increased expression of ABCB1 mRNA] which results in chemical resistance to Doxorubicin]
16223781
valspodar
  • valspodar affects the activity of ABCB1 protein
15788683
valspodar
  • valspodar inhibits the reaction [ABCB1 protein results in chemical resistance to Doxorubicin]
  • valspodar inhibits the reaction [ABCB1 protein results in decreased uptake of Doxorubicin]
17947497
valspodar
  • valspodar results in decreased activity of ABCB1 protein
11934808
valspodar
  • valspodar inhibits the reaction [ABCB1 protein results in increased export of Diazinon]
16221533
Verapamil
  • Verapamil results in decreased activity of ABCB1 protein
16026006
Verapamil
  • Verapamil results in decreased activity of ABCB1 protein
15666293
Verapamil
  • Verapamil does not affect the expression of ABCB1 mRNA
12387747
Verapamil
  • Verapamil binds to and results in decreased activity of ABCB1 protein
16959878
Verapamil
  • Verapamil results in decreased activity of ABCB1 protein
18408562, 11836167, 12387747, 15725475, 15627040, 15451006, 16049968
Verapamil
  • Verapamil results in increased activity of ABCB1 protein
16033948
Verapamil
  • Verapamil inhibits the reaction [ABCB1 protein results in increased export of Doxorubicin]
8917702
Verapamil
  • Verapamil inhibits the reaction [ABCB1 protein results in decreased uptake of Doxorubicin]
17947497, 17526808
Verapamil
  • [Verapamil results in decreased expression of ABCB1] promotes the reaction [Doxorubicin results in increased activity of CASP3 protein]
  • [Verapamil results in decreased expression of ABCB1] promotes the reaction [Doxorubicin results in increased activity of CASP7 protein]
15861398
Verapamil
  • Verapamil inhibits the reaction [ABCB1 protein results in chemical resistance to Doxorubicin]
17947497
Verapamil
  • Verapamil inhibits the reaction [ABCB1 protein affects the uptake of Vinblastine]
15640379
Verapamil
  • Verapamil promotes the reaction [ABCB1 protein mutant form binds to 8-azidoadenosine 5'-triphosphate]
11027628
Verapamil
  • Verapamil inhibits the reaction [Acetaminophen results in increased activity of ABCB1 protein]
  • Verapamil inhibits the reaction [Doxorubicin results in increased activity of ABCB1 protein]
17526808
verlukast
  • verlukast does not affect the reaction [ABCB1 protein results in increased export of Diazinon]
16221533
Vinblastine
  • ABCB1 protein results in increased transport of Vinblastine
  • Diazinon affects the reaction [ABCB1 protein results in increased transport of Vinblastine]
16221533
Vinblastine
  • ABCB1 protein results in chemical resistance to Vinblastine
8917702, 11355955, 15725475
Vinblastine
  • ABCB1 protein affects the uptake of Vinblastine
  • Verapamil inhibits the reaction [ABCB1 protein affects the uptake of Vinblastine]
15640379
Vinblastine
  • ABCB1 protein results in chemical resistance to Vinblastine
11455017
Vinblastine
  • Sesquiterpenes analog inhibits the reaction [ABCB1 protein results in chemical resistance to Vinblastine]
15466210
Vincristine
  • [Estradiol results in decreased expression of ABCB1 protein] which results in increased uptake of and results in chemical sensitivity to Vincristine
16925584
Vincristine
  • ABCB1 protein affects the uptake of Vincristine
11934808
Vincristine
  • Vincristine results in increased expression of ABCB1 protein
16038730, 15239124
Vincristine
  • ABCB1 protein results in decreased uptake of Vincristine
10617675
Vincristine
  • ABCB1 protein affects the chemical susceptibility to Vincristine
15645438
Vitamin A
  • 6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid inhibits the reaction [Vitamin A results in decreased expression of ABCB1 mRNA]
  • Mannitol inhibits the reaction [Vitamin A results in decreased expression of ABCB1 mRNA]
  • Vitamin A results in decreased expression of ABCB1 mRNA
15327746
Zidovudine
  • Zidovudine results in increased expression of ABCB1 mRNA
15456083

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Epilepsy marker 8001500
Liver Cirrhosis, Experimental marker 17072980
Anemia inferred via Vitamin A 16960172
Anemia, Iron-Deficiency inferred via Vitamin A 16960172
Asthma inferred via Vitamin A 16732791
Bronchopulmonary Dysplasia inferred via Vitamin A 17426644, 17377406
Child Nutrition Disorders inferred via Vitamin A 16153327
Cholestasis inferred via Vitamin A 16175620
Cleft Palate inferred via Vitamin A 16054864
Colonic Neoplasms inferred via Vitamin A 17219422, 16267017
Diabetes Mellitus, Type 1 inferred via Vitamin A 16506275
Dry Eye Syndromes inferred via Vitamin A 16146918
Ectromelia inferred via Vitamin A 16054864
Fetal Resorption inferred via Vitamin A 16054864
Heart Defects, Congenital inferred via Vitamin A 16080930
Hernia, Diaphragmatic inferred via Vitamin A 17436238, 16863852, 16877224, 16490937, 16292552
HIV Infections inferred via Vitamin A 16960176
HIV Seropositivity inferred via Vitamin A 17209195
Hypervitaminosis A inferred via Vitamin A 16054864
Limb Deformities, Congenital inferred via Vitamin A 16054864
Liver Cirrhosis inferred via Vitamin A 16256175
Liver Cirrhosis, Experimental inferred via Vitamin A 16248980
Liver Diseases inferred via Vitamin A 16175620
Liver Diseases, Alcoholic inferred via Vitamin A 16762690
Liver Neoplasms, Experimental inferred via Vitamin A 17113696
Lung Diseases inferred via Vitamin A 16863852
Multiple Myeloma inferred via Vitamin A 16374440
Neural Tube Defects inferred via Vitamin A 17400914
Respiratory Distress Syndrome, Newborn inferred via Vitamin A 16877224
Vitamin A Deficiency inferred via Vitamin A 16960172, 16146918, 16175781
Carcinoma, Renal Cell inferred via Vincristine 16201981
Hodgkin Disease inferred via Vincristine 17606976, 15147373, 16135485, 16794504
Melanoma, Amelanotic inferred via Vincristine 15990972
Myocardial Infarction inferred via Vincristine 17284715
Hodgkin Disease inferred via Vinblastine 18180244, 18501091
Melanoma inferred via Vinblastine 16809738, 15577320, 18176117, 18505091, 16248763, 16432458, 15577323, 12374674, 18332650, 17761969
Neutropenia inferred via Vinblastine 17378895
Vaginal Neoplasms inferred via Vinblastine 15577323
Mammary Neoplasms, Experimental inferred via valspodar 14633655
Dystonia inferred via Valproic Acid 1851702
Fatty Liver inferred via Valproic Acid 14986274
Leukemia, Myeloid, Acute inferred via Valproic Acid 16294345
Migraine Disorders inferred via Valproic Acid 18765137, 18803445
Pseudolymphoma inferred via Valproic Acid 12752131
Seizures inferred via Valproic Acid 11738929
Unverricht-Lundborg Syndrome inferred via Valproic Acid 3119515
Acrocephalosyndactylia inferred via U 0126 17694057
Leukemia, Monocytic, Acute inferred via U 0126 16972261
Ovarian Neoplasms inferred via U 0126 16211241
Breast Neoplasms inferred via Trichloroethylene 15986119
Alopecia inferred via Tretinoin 15955085
Arthritis, Experimental inferred via Tretinoin 16412693
Arthritis, Rheumatoid inferred via Tretinoin 16292516
Asthma inferred via Tretinoin 16456186
Barrett Esophagus inferred via Tretinoin 16935849
Blood Coagulation Disorders inferred via Tretinoin 16197459, 16206674
Breast Neoplasms inferred via Tretinoin 16873071, 16443354, 16166294
Bronchopulmonary Dysplasia inferred via Tretinoin 16813970
Carcinoma, Embryonal inferred via Tretinoin 16168501
Carcinoma, Squamous Cell inferred via Tretinoin 16096774, 16051514
Cataract inferred via Tretinoin 17460283
Cervical Intraepithelial Neoplasia inferred via Tretinoin 16129372
Choriocarcinoma inferred via Tretinoin 16461808
Colitis inferred via Tretinoin 17035595
Craniofacial Abnormalities inferred via Tretinoin 16925845
Endometrial Neoplasms inferred via Tretinoin 16569247
Eye Abnormalities inferred via Tretinoin 16938888
Glioblastoma inferred via Tretinoin 17312396
Head and Neck Neoplasms inferred via Tretinoin 16096774
Hearing Loss, Noise-Induced inferred via Tretinoin 16084493
Hyperalgesia inferred via Tretinoin 16870215
Hypereosinophilic Syndrome inferred via Tretinoin 16778211
Leukemia inferred via Tretinoin 17143497
Leukemia, Myeloid inferred via Tretinoin 16932348, 16482212
Leukemia, Myeloid, Acute inferred via Tretinoin 16294345
Leukemia, Promyelocytic, Acute inferred via Tretinoin 16891316, 17301526, 17339181, 17506722, 17217047, 16766008, 17107899, 16788101, 16935935, 15748426, 16140955, 16331271, 17294898, 17361223, 17368321, 12679006, 16823087
Liver Cirrhosis, Experimental inferred via Tretinoin 16248980, 18397230
Medulloblastoma inferred via Tretinoin 17453147
Melanoma inferred via Tretinoin 16752155
Meningomyelocele inferred via Tretinoin 16940565
Neoplasms inferred via Tretinoin 16946489, 16594593
Ovarian Neoplasms inferred via Tretinoin 16936753
Pain inferred via Tretinoin 16870215
Pancreatic Neoplasms inferred via Tretinoin 15976015
Pterygium inferred via Tretinoin 16723453
Rhabdomyosarcoma inferred via Tretinoin 16116481, 16283617
Skin Neoplasms inferred via Tretinoin 16467112
Stomach Neoplasms inferred via Tretinoin 17261132
Thyroid Neoplasms inferred via Tretinoin 17045167, 16026305
Tongue Neoplasms inferred via Tretinoin 16051514
Tuberculosis inferred via Tretinoin 16040207
Uterine Cervical Neoplasms inferred via Tretinoin 16129372
Uveal Neoplasms inferred via Tretinoin 16752155
Vitiligo inferred via Tretinoin 16761959
Wilms Tumor inferred via Tretinoin 16287080
Lung Neoplasms inferred via tipifarnib 16885199
Mammary Neoplasms, Experimental inferred via tipifarnib 16648579
Liver Cirrhosis, Experimental inferred via Thioacetamide 16248980, 18395095, 18295389, 16097051
Abnormalities, Drug-Induced inferred via Thalidomide 8333272
Amyotrophic Lateral Sclerosis inferred via Thalidomide 16510725
Carcinoma, Hepatocellular inferred via Thalidomide 16313753
Colitis inferred via Thalidomide 16680017
Crohn Disease inferred via Thalidomide 16078585
Giant Lymph Node Hyperplasia inferred via Thalidomide 12701121
Glioma inferred via Thalidomide 16327979
Inflammation inferred via Thalidomide 16134734
Limb Deformities, Congenital inferred via Thalidomide 10473037
Liver Cirrhosis inferred via Thalidomide 17174718, 16943688
Melanoma inferred via Thalidomide 17089043, 16098027, 12829675
Multiple Myeloma inferred via Thalidomide 15867202, 15939924, 15920492, 17168659, 16445831, 15744524
Nervous System Malformations inferred via Thalidomide 16859833
Ovarian Neoplasms inferred via Thalidomide 16288038
Precursor Cell Lymphoblastic Leukemia-Lymphoma inferred via Thalidomide 17031469
Prostatic Neoplasms inferred via Thalidomide 16729912
Prurigo inferred via Thalidomide 12755975
Schnitzler Syndrome inferred via Thalidomide 16096327
Fatty Liver inferred via Tetracycline 16917069
Hepatitis, Toxic inferred via Tetracycline 17522070
Nephritis, Interstitial inferred via Tetracycline 9884423
Pemphigoid, Bullous inferred via Tetracycline 11026799
Prion Diseases inferred via Tetracycline 10903871
Adenoma, Liver Cell inferred via Tetrachlorodibenzodioxin 16835633
Carcinoma inferred via Tetrachlorodibenzodioxin 16835633
Cholangiocarcinoma inferred via Tetrachlorodibenzodioxin 16835633
Cleft Palate inferred via Tetrachlorodibenzodioxin 8697196
Diabetes Mellitus, Type 2 inferred via Tetrachlorodibenzodioxin 17107852
Hydronephrosis inferred via Tetrachlorodibenzodioxin 8697196
Liver Neoplasms inferred via Tetrachlorodibenzodioxin 16984957
Neoplasms inferred via terameprocol 15958646
Breast Neoplasms inferred via Tamoxifen 16202921, 11161223, 15668708, 17440819, 17893378, 17261762, 17049068, 16818667, 16873071, 15565566, 17242785
Carcinoma, Hepatocellular inferred via Tamoxifen 16924424
Carcinoma, Transitional Cell inferred via Tamoxifen 17572228
Endometrial Neoplasms inferred via Tamoxifen 16202921, 17893378
Fatty Liver inferred via Tamoxifen 14986274
Female Urogenital Diseases inferred via Tamoxifen 16709447
Lipidoses inferred via Tamoxifen 15342952
Liver Cirrhosis, Experimental inferred via Tamoxifen 18564211
Liver Neoplasms inferred via Tamoxifen 16684651
Mammary Neoplasms, Experimental inferred via Tamoxifen 11731420, 16827153, 14580682
Melanoma inferred via Tamoxifen 12393984
Melanoma, Amelanotic inferred via Tamoxifen 15990972
Spermatocele inferred via Tamoxifen 16709447
Urinary Bladder Neoplasms inferred via Tamoxifen 16712894, 17572228
Duodenal Ulcer inferred via Tacrolimus 17202747
Graft vs Host Disease inferred via Tacrolimus 16376943
Neurodegenerative Diseases inferred via Tacrolimus 15081597
Adrenal Gland Neoplasms inferred via sodium arsenite 15276417
Adrenocortical Adenoma inferred via sodium arsenite 16712894
Carcinoma, Hepatocellular inferred via sodium arsenite 15276417, 16507464
Carcinoma, Squamous Cell inferred via sodium arsenite 18572023
Genital Neoplasms, Female inferred via sodium arsenite 16452187
Hodgkin Disease inferred via sodium arsenite 12676792
Liver Neoplasms inferred via sodium arsenite 15276417, 16712894
Lung Neoplasms inferred via sodium arsenite 15276417, 16712894, 17077188
Melanoma inferred via sodium arsenite 16487513
Neoplasms inferred via sodium arsenite 11559025
Neural Tube Defects inferred via sodium arsenite 12854658
Ovarian Neoplasms inferred via sodium arsenite 15276417
Prostatic Neoplasms inferred via sodium arsenite 16039940
Skin Neoplasms inferred via sodium arsenite 18572023
Spinal Dysraphism inferred via sodium arsenite 12854658
Urinary Bladder Neoplasms inferred via sodium arsenite 11723127, 16452187, 16712894
Uterine Cervical Neoplasms inferred via sodium arsenite 11813266
Vascular Diseases inferred via sodium arsenite 17056641
Hyperlipoproteinemia Type II inferred via Simvastatin 16238680
Polycystic Ovary Syndrome inferred via Simvastatin 17105841
HIV Infections inferred via Saquinavir 15388451
Mycobacterium Infections inferred via Rifampin 18474467
Tuberculosis inferred via Rifampin 18397238, 15236969
Arteriosclerosis inferred via Reserpine 10729376
Breast Neoplasms inferred via Reserpine 11921183
Hemangioendothelioma inferred via Razoxane 15380572
Albuminuria inferred via Raloxifene 17308373, 17451421
Alzheimer Disease inferred via Raloxifene 15800139
Brain Injuries inferred via Raloxifene 16580743
Breast Neoplasms inferred via Raloxifene 17242785, 15775269, 17440819, 16912660, 16837676, 17893378, 17595753, 17952589, 15758505, 17261762, 17049068, 15572757
Carcinoma, Transitional Cell inferred via Raloxifene 17572228
Cardiovascular Diseases inferred via Raloxifene 15775269
Cognition Disorders inferred via Raloxifene 15800139
Depressive Disorder, Major inferred via Raloxifene 17474826
Diabetic Nephropathies inferred via Raloxifene 17308373, 17451421, 15920148
Edema inferred via Raloxifene 15860553
Encephalomyelitis, Autoimmune, Experimental inferred via Raloxifene 15845917
Fatty Liver inferred via Raloxifene 17473493
Heart Diseases inferred via Raloxifene 11110106
Hypertension inferred via Raloxifene 15787275, 17577099
Leiomyoma inferred via Raloxifene 16973256
Mixed Tumor, Mullerian inferred via Raloxifene 15863610
Multiple Myeloma inferred via Raloxifene 16497877
Myxoma inferred via Raloxifene 16343187
Osteoporosis inferred via Raloxifene 15775268, 17882678
Osteoporosis, Postmenopausal inferred via Raloxifene 15758505, 17893378, 15579764, 17823083
Prostatic Neoplasms inferred via Raloxifene 16220300, 15731164, 16536755
Purpura inferred via Raloxifene 15770314
Stroke inferred via Raloxifene 16837676
Urinary Bladder Neoplasms inferred via Raloxifene 17572228
Venous Thromboembolism inferred via Raloxifene 16837676
Vulvar Neoplasms inferred via Raloxifene 16343187
Myotonia Congenita inferred via Quinine 1896199
Cadmium Poisoning inferred via Quercetin 16962696
Influenza, Human inferred via Quercetin 16624496
Kidney Diseases inferred via Quercetin 16962696
Liver Cirrhosis, Experimental inferred via Quercetin 12741479
Neurogenic Inflammation inferred via Quercetin 17929310
Pancreatic Neoplasms inferred via Quercetin 16965848
Hypercholesterolemia inferred via Pravastatin 17188708
Myocardial Infarction inferred via Pravastatin 17188708
Alzheimer Disease inferred via Plant Extracts 16962711
Brain Ischemia inferred via Plant Extracts 16041641
HIV Infections inferred via Plant Extracts 12878215
Hot Flashes inferred via Plant Extracts 16566672
Hyperhomocysteinemia inferred via Plant Extracts 16484555
Inflammation inferred via Plant Extracts 16366677
Liver Cirrhosis, Experimental inferred via Plant Extracts 15479170
Neurobehavioral Manifestations inferred via Plant Extracts 17168769
Prostatic Neoplasms inferred via Plant Extracts 17804756
Mastocytosis, Systemic inferred via PKC412 17420286
Liver Cirrhosis, Experimental inferred via Phosphatidylcholines 16169303
Abnormalities, Drug-Induced inferred via Phenytoin 3425630, 10563481
Atherosclerosis inferred via Phenytoin 15136057
Cleft Palate inferred via Phenytoin 2227380, 10789828, 3877104, 6862529, 6856622, 1687470
Congenital Abnormalities inferred via Phenytoin 10627286
Drug Eruptions inferred via Phenytoin 15024534
Epidermolysis Bullosa inferred via Phenytoin 6251365, 1399206
Epilepsies, Partial inferred via Phenytoin 17116037
Epilepsy inferred via Phenytoin 11434505
Fetal Death inferred via Phenytoin 10627286
Gingival Hyperplasia inferred via Phenytoin 9029455
Gingival Overgrowth inferred via Phenytoin 16390469, 14659971
Hyperhomocysteinemia inferred via Phenytoin 10459572
Liver Diseases inferred via Phenytoin 14986274
Myoclonic Epilepsies, Progressive inferred via Phenytoin 17484760
Myotonia Congenita inferred via Phenytoin 1896199
Osteomalacia inferred via Phenytoin 17016548
Pseudolymphoma inferred via Phenytoin 1419762, 8603615, 12752131
Dystonia inferred via Phenobarbital 1851702
Epilepsy, Absence inferred via Phenobarbital 6401628
Liver Neoplasms inferred via Phenobarbital 15975961, 8742319
Myoclonic Epilepsies, Progressive inferred via Phenobarbital 17484760
Osteomalacia inferred via Phenobarbital 17016548
Pancreatic Neoplasms inferred via Phenobarbital 16965848
Pseudolymphoma inferred via Phenobarbital 12752131
Seizures, Febrile inferred via Phenobarbital 6407741
Testicular Diseases inferred via phenethyl isothiocyanate 15864552
Agricultural Workers' Diseases inferred via Parathion 11874814, 17119214
Breast Neoplasms inferred via Parathion 12762645
Infertility, Male inferred via Parathion 16029889
Respiratory Sounds inferred via Parathion 11874814, 17119214
Respiratory Tract Diseases inferred via Parathion 17119214
Breast Neoplasms inferred via Paclitaxel 16244791, 11325840, 18234424, 18323546, 15136595
Carcinoma, Hepatocellular inferred via Paclitaxel 16313753
Liposarcoma inferred via Paclitaxel 17353645
Lymphoma, Non-Hodgkin inferred via Paclitaxel 14749477
Melanoma inferred via Paclitaxel 16342250, 12040289
Multiple Myeloma inferred via Paclitaxel 14749477
Ovarian Neoplasms inferred via Paclitaxel 11161223
Prostatic Neoplasms inferred via Paclitaxel 16356831, 16729912, 17136230
Heart Failure inferred via NK 104 15502390
HIV Infections inferred via Nelfinavir 15388451
Pruritus inferred via Naloxone 15861022
Heart Diseases inferred via Mitoxantrone 16019553
Leukemia, Lymphocytic, Chronic, B-Cell inferred via Mitoxantrone 18172266
Neoplasms inferred via Mitoxantrone 16640825
Fibrosarcoma inferred via Methylcholanthrene 14633661
Lung Neoplasms inferred via Methylcholanthrene 17909032, 11893704, 16337739, 16271038
Arthritis, Rheumatoid inferred via Methotrexate 17286800
Breast Neoplasms inferred via Methotrexate 16978400
Graft vs Host Disease inferred via Methotrexate 16518429
Liver Cirrhosis inferred via Methotrexate 14986274
Mucositis inferred via Methotrexate 17488658
Psoriasis inferred via Methotrexate 17410198
Neoplasms inferred via meloxicam 16684565
Hodgkin Disease inferred via Lomustine 16135485
Melanoma inferred via Lomustine 15577320
Epilepsies, Partial inferred via lamotrigine 17116037
Prostatic Neoplasms inferred via Ketoconazole 17404083
Colonic Neoplasms inferred via irinotecan 17725105
Colorectal Neoplasms inferred via irinotecan 16303861, 17454858, 18259882, 15273666
Neoplasm Metastasis inferred via irinotecan 18259882
Stomach Neoplasms inferred via irinotecan 15723263
Breast Neoplasms inferred via indole-3-carbinol 16082211
Uterine Cervical Neoplasms inferred via indole-3-carbinol 16082211
Breast Neoplasms inferred via imatinib 17614352
Leukemia, Myelogenous, Chronic, BCR-ABL Positive inferred via imatinib 15748426, 17301526
Liver Cirrhosis, Experimental inferred via imatinib 16596278
Neoplasms, Hormone-Dependent inferred via imatinib 17614352
Precursor Cell Lymphoblastic Leukemia-Lymphoma inferred via imatinib 12476293
Thyroid Neoplasms inferred via imatinib 16940797
Migraine Disorders inferred via gabapentin 18803445, 18759728
Breast Neoplasms inferred via Fluorouracil 15136595
Carcinoid Tumor inferred via Fluorouracil 16051944
Colonic Neoplasms inferred via Fluorouracil 17725105
Colorectal Neoplasms inferred via Fluorouracil 17594712, 17695437, 17255274, 16303861, 17401013, 17454858
Bone Marrow Neoplasms inferred via Etoposide 14601052
Breast Neoplasms inferred via Etoposide 16322251
Herpes Simplex inferred via Etoposide 10809021
Hodgkin Disease inferred via Etoposide 17606976, 18180244, 15147373, 16135485, 16200630
Lymphoma inferred via Etoposide 12556972, 12854902
Sarcoma, Ewing's inferred via Etoposide 14601052
Seizures inferred via etiracetam 11738929
Kidney Neoplasms inferred via Estrone 15610895
Breast Neoplasms inferred via Estradiol 17289903, 14630087, 12948864, 18497071, 17018787, 17261762
Candidiasis, Vulvovaginal inferred via Estradiol 16111702
Carcinoma, Hepatocellular inferred via Estradiol 16924424
Herpes Genitalis inferred via Estradiol 15709030
Hot Flashes inferred via Estradiol 17088409
Insulin Resistance inferred via Estradiol 16393666, 16627594
Kidney Diseases inferred via Estradiol 15618244
Kidney Neoplasms inferred via Estradiol 15610895
Liver Cirrhosis, Experimental inferred via Estradiol 14716833, 14659978
Mammary Neoplasms, Experimental inferred via Estradiol 17203775, 11807958, 11408345, 16891317
Myocardial Reperfusion Injury inferred via Estradiol 16810080
Neovascularization, Pathologic inferred via Estradiol 17289903
Prostatic Neoplasms inferred via Estradiol 16740699
Hepatitis, Toxic inferred via Erythromycin Estolate 17522070
Breast Neoplasms inferred via Epirubicin 17388661, 15093573, 18511948, 12006526
Hodgkin Disease inferred via Epirubicin 18180244
Cyanosis inferred via Endosulfan 7900959
Dyspnea inferred via Endosulfan 7900959, 3388749
Emphysema inferred via Endosulfan 7900959
Hemorrhage inferred via Endosulfan 7900959
Infertility, Male inferred via Endosulfan 8588293, 9432128
Learning Disorders inferred via Endosulfan 8157075
Seizures inferred via Endosulfan 10698677, 7539098
Dengue inferred via Doxycycline 17502914
Osteoarthritis inferred via Doxycycline 17267227
Pemphigoid, Bullous inferred via Doxycycline 11026799
Adenocarcinoma inferred via Doxorubicin 17418594
Bone Marrow Neoplasms inferred via Doxorubicin 14601052
Brain Neoplasms inferred via Doxorubicin 17150277
Breast Neoplasms inferred via Doxorubicin 15692762, 17983394, 15939500, 17426702, 16826403, 18382427, 15993339, 15634643, 15567936, 15994142, 15668708, 16264153, 18234424, 17369602, 16935488, 15136595, 11325840, 16322301, 16096432, 18628466
Carcinoid Tumor inferred via Doxorubicin 16051944
Carcinoma, Hepatocellular inferred via Doxorubicin 18059187, 16234567, 17876044, 16023760
Carcinoma, Renal Cell inferred via Doxorubicin 16201981
Cardiomyopathies inferred via Doxorubicin 16952015, 15811867, 17007740, 17382496, 16731534, 15505089, 16278810, 15476868, 16269455, 16109756, 16242529, 16364871, 16651473, 17351982, 17131338, 16455267, 18627295, 17329180, 17974986, 17308081
Cardiomyopathy, Dilated inferred via Doxorubicin 17334414, 16243910
Colorectal Neoplasms inferred via Doxorubicin 18259882
Drug Toxicity inferred via Doxorubicin 18602426
Endometrial Neoplasms inferred via Doxorubicin 17359293
Endomyocardial Fibrosis inferred via Doxorubicin 18037988
Glioblastoma inferred via Doxorubicin 17150277
Head and Neck Neoplasms inferred via Doxorubicin 15692506
Heart Diseases inferred via Doxorubicin 16707910, 16330681, 16879835, 16244372, 16244371, 16144979
Hemangiosarcoma inferred via Doxorubicin 15692506
Hepatitis, Toxic inferred via Doxorubicin 17416283
Hodgkin Disease inferred via Doxorubicin 17606976, 15147373, 18501091
Kidney Diseases inferred via Doxorubicin 16775033, 15369732
Kidney Failure inferred via Doxorubicin 17922066
Kidney Failure, Chronic inferred via Doxorubicin 16707910
Leukemia, Erythroblastic, Acute inferred via Doxorubicin 16085563
Liver Cirrhosis, Experimental inferred via Doxorubicin 16595196, 16439617
Liver Neoplasms, Experimental inferred via Doxorubicin 17085340, 16842330
Lung Neoplasms inferred via Doxorubicin 17418594
Lymphoma inferred via Doxorubicin 16098063
Lymphoma, Non-Hodgkin inferred via Doxorubicin 17654614
Lymphoma, T-Cell inferred via Doxorubicin 15621674
Mammary Neoplasms, Experimental inferred via Doxorubicin 15458769
Melanoma inferred via Doxorubicin 16827129
Mucositis inferred via Doxorubicin 17415656
Neoplasm Metastasis inferred via Doxorubicin 18259882
Nephrotic Syndrome inferred via Doxorubicin 15640375, 16889571
Neuroblastoma inferred via Doxorubicin 15555623
Osteosarcoma inferred via Doxorubicin 15930896
Phyllodes Tumor inferred via Doxorubicin 17983394
Prostatic Neoplasms inferred via Doxorubicin 15897917, 15749863, 18437689, 16729912, 16888761, 16868541
Sarcoma inferred via Doxorubicin 18313854, 17710206, 15625365, 15675481, 17203757, 16767912
Sarcoma, Ewing's inferred via Doxorubicin 14601052, 16326096
Sarcoma, Kaposi inferred via Doxorubicin 17846226
Skin Neoplasms inferred via Doxorubicin 15692506
Soft Tissue Neoplasms inferred via Doxorubicin 16767912, 17203757, 15625365
Thyroid Neoplasms inferred via Doxorubicin 17909728, 16010429
Urinary Bladder Neoplasms inferred via Doxorubicin 17653716
Ventricular Dysfunction, Left inferred via Doxorubicin 17334414, 16364871
Breast Neoplasms inferred via docetaxel 15692762, 17369602, 15567936, 16264153, 18628466
Melanoma inferred via docetaxel 12417787
Prostatic Neoplasms inferred via docetaxel 16644109, 16520278
Adenocarcinoma inferred via Dimethylnitrosamine 16033868
Carcinoma, Squamous Cell inferred via Dimethylnitrosamine 16033868
Esophageal Neoplasms inferred via Dimethylnitrosamine 17016578
Liver Cirrhosis, Experimental inferred via Dimethylnitrosamine 17203207, 15383259, 14659978, 14568256, 16570917, 18095165, 17465448, 17036385, 18210741, 17534399, 17201889, 18237412, 17719030, 15081153, 16169303, 14643895, 18567088, 15798949, 15571005, 18672772, 15067225, 17640959, 18364076, 15369754, 15099470, 14709902, 15577212, 15504291, 15339415, 17432682, 17198567, 15086199, 15733078, 16009107, 18637143, 17666798, 15138612, 16603200, 17724770, 15723089, 14726149, 16627068, 15942678, 15744066, 15591649, 18239293, 16270385, 17881167, 15492853, 18629640, 15864749, 15763062, 16544323, 15842777, 15793283, 18371158, 12925901, 15366600, 17348192, 15161499, 12918455, 15298665, 16042886, 15479170, 17196135
Liver Failure, Acute inferred via Dimethylnitrosamine 17457977
Liver Neoplasms inferred via Dimethylnitrosamine 3113478, 15890375
Liver Neoplasms, Experimental inferred via Dimethylnitrosamine 15603536
Lung Neoplasms inferred via Dimethylnitrosamine 16061637
Stomach Neoplasms inferred via Dimethylnitrosamine 16033868
Amyloidosis inferred via Diethylstilbestrol 15469931
Breast Neoplasms inferred via Diethylstilbestrol 15324884, 17129689
Carcinoma, Hepatocellular inferred via Diethylstilbestrol 16924424, 15948411
Cryptorchidism inferred via Diethylstilbestrol 12952375, 16002989
Endometrial Hyperplasia inferred via Diethylstilbestrol 16402032
Endometrial Neoplasms inferred via Diethylstilbestrol 15700306, 16804899
Female Urogenital Diseases inferred via Diethylstilbestrol 16513791, 16534752, 16002989, 16611131, 15751030
Genital Neoplasms, Female inferred via Diethylstilbestrol 16452187
Hyperplasia inferred via Diethylstilbestrol 12960047, 14722030
Hypospadias inferred via Diethylstilbestrol 16002989
Infertility inferred via Diethylstilbestrol 15036965
Kidney Neoplasms inferred via Diethylstilbestrol 15003126, 16762066, 14681315
Liver Neoplasms inferred via Diethylstilbestrol 16712894, 15890375
Lupus Nephritis inferred via Diethylstilbestrol 15166399
Lymphoma inferred via Diethylstilbestrol 15700306
Male Urogenital Diseases inferred via Diethylstilbestrol 16002989
Neoplasms inferred via Diethylstilbestrol 15313581
Pituitary Diseases inferred via Diethylstilbestrol 14722030
Pituitary Neoplasms inferred via Diethylstilbestrol 15687265, 16977796
Prostatic Neoplasms inferred via Diethylstilbestrol 15846301, 17136230, 15046698
Spermatocele inferred via Diethylstilbestrol 16709447, 16002989
Urinary Bladder Neoplasms inferred via Diethylstilbestrol 16712894, 16452187
Uterine Cervical Neoplasms inferred via Diethylstilbestrol 16175088
Uterine Diseases inferred via Diethylstilbestrol 14652134
Uterine Neoplasms inferred via Diethylstilbestrol 15809267, 16690809
Vaginal Neoplasms inferred via Diethylstilbestrol 16513791, 16002989
Dermatitis, Atopic inferred via Diethylhexyl Phthalate 16882537
Agricultural Workers' Diseases inferred via Dichlorodiphenyl Dichloroethylene 16487989
Breast Neoplasms inferred via Dichlorodiphenyl Dichloroethylene 15061365
Dyspnea inferred via Dichlorodiphenyl Dichloroethylene 16487989
Hepatitis inferred via Dichlorodiphenyl Dichloroethylene 16487989
Infertility, Male inferred via Dichlorodiphenyl Dichloroethylene 12948891, 17192596
Limb Deformities, Congenital inferred via Dichlorodiphenyl Dichloroethylene 12745335
Urologic Diseases inferred via Dichlorodiphenyl Dichloroethylene 16487989
Agricultural Workers' Diseases inferred via Diazinon 16487989
Dyspnea inferred via Diazinon 16487989
Hepatitis inferred via Diazinon 16487989
Infertility, Male inferred via Diazinon 16466525, 12948887
Poisoning inferred via Diazinon 17603234
Urologic Diseases inferred via Diazinon 16487989
Colonic Neoplasms inferred via Dexamethasone 15824018
Liver Cirrhosis, Experimental inferred via Dexamethasone 16718785
Lung Neoplasms inferred via Dexamethasone 15824018, 11195469
Multiple Myeloma inferred via Dexamethasone 15867202, 15744524, 16118317
Respiratory Distress Syndrome, Adult inferred via Dexamethasone 11700416
Adenoma, Liver Cell inferred via DDT 12597452
Agricultural Workers' Diseases inferred via DDT 12584743, 16487989
Breast Neoplasms inferred via DDT 16792888, 12709520
Carcinoma, Hepatocellular inferred via DDT 12597452
Dyspnea inferred via DDT 16487989
Hepatitis inferred via DDT 16487989
Hepatomegaly inferred via DDT 2387028
Infertility, Male inferred via DDT 17192596, 17157474
Liver Diseases inferred via DDT 15729006
Liver Neoplasms inferred via DDT 15975961, 11948501
Neoplasms inferred via DDT 8820588
Prostatic Neoplasms inferred via DDT 12584743
Urologic Diseases inferred via DDT 16487989
Bone Marrow Neoplasms inferred via Dactinomycin 14601052
Sarcoma, Ewing's inferred via Dactinomycin 14601052
Hodgkin Disease inferred via Cytarabine 16200630
Gingival Hyperplasia inferred via Cyclosporine 8708960
Metal Metabolism, Inborn Errors inferred via Cyclosporine 16801185
Nephrosis, Lipoid inferred via Cyclosporine 17954296
Nephrotic Syndrome inferred via Cyclosporine 18481113
Psoriasis inferred via Cyclosporine 16882103
Arteriosclerosis inferred via Cyclophosphamide 15014928
Breast Neoplasms inferred via Cyclophosphamide 17388661, 18234424, 11325840, 15136595, 15093573, 16978400, 12006526, 18323546
Carcinoma, Lewis Lung inferred via Cyclophosphamide 16152834
Carcinoma, Renal Cell inferred via Cyclophosphamide 16201981
Cystitis inferred via Cyclophosphamide 11948286, 16614059, 18295254, 18433785, 15276878, 18710439, 12913760, 16651033, 16989017, 12388444, 10498854, 15643279, 18483878, 17979934, 16413132, 10700343, 17010015
Diabetes Mellitus, Experimental inferred via Cyclophosphamide 11751995, 15331540, 10990075
Diabetes Mellitus, Type 1 inferred via Cyclophosphamide 18772604
Eosinophilia inferred via Cyclophosphamide 11006010
Gliosarcoma inferred via Cyclophosphamide 11389073
GLOBOZOOSPERMIA inferred via Cyclophosphamide 16517039
Graft vs Host Disease inferred via Cyclophosphamide 11014644, 15172196, 16376943
Hemophilia A inferred via Cyclophosphamide 11918545
Hepatic Veno-Occlusive Disease inferred via Cyclophosphamide 14986274
Hodgkin Disease inferred via Cyclophosphamide 17606976, 16135485
Infertility, Male inferred via Cyclophosphamide 16517039
Leukemia inferred via Cyclophosphamide 10602166
Leukemia, Lymphocytic, Chronic, B-Cell inferred via Cyclophosphamide 18587576, 17658394, 17296974, 18172266, 17802794, 17008537
Leukopenia inferred via Cyclophosphamide 10052129, 11830472
Lymphoma inferred via Cyclophosphamide 12854902
Lymphoma, B-Cell inferred via Cyclophosphamide 16675587
Lymphoma, Non-Hodgkin inferred via Cyclophosphamide 11911406
Melanoma, Experimental inferred via Cyclophosphamide 16388313
Neuroblastoma inferred via Cyclophosphamide 16115947, 15176712
Oligospermia inferred via Cyclophosphamide 16517039
Pancreatic Neoplasms inferred via Cyclophosphamide 11332152
Prostatic Neoplasms inferred via Cyclophosphamide 17136230
Pulmonary Fibrosis inferred via Cyclophosphamide 16636934
Scleroderma, Systemic inferred via Cyclophosphamide 16636934
Urinary Bladder Neoplasms inferred via Cyclophosphamide 14692829
Breast Neoplasms inferred via Curcumin 16243823
Inflammation inferred via Curcumin 16956363, 17151092
Leukemia-Lymphoma, Adult T-Cell inferred via Curcumin 16106398
Leukemia, T-Cell inferred via Curcumin 16106398
Liver Cirrhosis, Experimental inferred via Curcumin 18006644
Liver Diseases inferred via Curcumin 16956363
Lung Neoplasms inferred via Curcumin 16243823
Lymphoma, T-Cell inferred via Curcumin 16173963
Memory Disorders inferred via Curcumin 17263510
Muscular Atrophy, Spinal inferred via Curcumin 17962980
Respiratory Distress Syndrome, Adult inferred via Curcumin 10666014
Adenocarcinoma inferred via Cisplatin 11798837
Bone Marrow Neoplasms inferred via Cisplatin 14601052
Breast Neoplasms inferred via Cisplatin 18382427
Colorectal Neoplasms inferred via Cisplatin 15273666
Hodgkin Disease inferred via Cisplatin 16170182, 16200630
Kidney Failure, Acute inferred via Cisplatin 12690470
Lung Neoplasms inferred via Cisplatin 11798837, 17225452
Melanoma inferred via Cisplatin 16809738, 18176117, 17761969, 12883367, 12393984, 12374674, 18332650, 15577323, 18505091, 16432458, 17023156, 16248763
Melanoma, Amelanotic inferred via Cisplatin 15990972
Neoplasms inferred via Cisplatin 16773208
Ovarian Neoplasms inferred via Cisplatin 17225452
Sarcoma, Ewing's inferred via Cisplatin 14601052
Testicular Neoplasms inferred via Cisplatin 17225452
Urinary Bladder Neoplasms inferred via Cisplatin 12973940, 17225452
Vaginal Neoplasms inferred via Cisplatin 15577323
Agricultural Workers' Diseases inferred via Chlorpyrifos 11874814, 17119214, 16611668
Liver Diseases inferred via Chlorpyrifos 15991261
Respiratory Sounds inferred via Chlorpyrifos 11874814, 16611668, 17119214
Respiratory Tract Diseases inferred via Chlorpyrifos 17119214, 16611668
Hepatitis, Toxic inferred via Chloroform 3104120, 17522070
Lipidoses inferred via chlorcyclizine 15342952
Lymphoma inferred via Chlorambucil 10745627
Brain Neoplasms inferred via Carmustine 16187019
Glioblastoma inferred via Carmustine 16187019
Melanoma inferred via Carmustine 12393984
Carbon Tetrachloride Poisoning inferred via Carbon Tetrachloride 16192424, 16011737, 15700767, 16124888, 16227642, 10355542, 16097048, 16050911, 15673190
Fatty Liver inferred via Carbon Tetrachloride 16045604, 15959796, 12795759, 61145, 12631006, 17595544, 16239168
Hepatitis, Toxic inferred via Carbon Tetrachloride 17522070, 15027814, 15968718, 16227642, 15998439, 16177239, 11566570
Hyperbilirubinemia inferred via Carbon Tetrachloride 16899240
Liver Cirrhosis inferred via Carbon Tetrachloride 17174718, 16221502, 16943688, 17334410, 16239168
Liver Cirrhosis, Experimental inferred via Carbon Tetrachloride 16192424, 15925388, 16116963, 17525996, 17557913, 18156304, 16638106, 18205269, 14716496, 15730626, 12632514, 15052691, 12632512, 17766677, 18418968, 12666154, 14748882, 13678700, 15818738, 17631135, 16097048, 15673190, 12649538, 17721639, 18277467, 15057751, 12586293, 18054572, 10355542, 16011737, 18251166, 17823541, 17944888, 18395914, 17714472, 14512876, 12609069, 18166357, 17922224, 18420326, 15876570, 12445421, 12445418, 15959796, 12898905, 18317297, 17761835, 14620537, 18472332, 14716833, 16136751, 17481882, 17900296, 15123356, 18339082, 18429990, 12546737, 18006644, 18481824, 18279442, 16027843, 15996030, 16033810, 17565644, 17869086, 17708605, 12667390, 18376398, 12389079, 18187930, 18210741, 16015684, 12741479, 14724832, 18472094, 15931870, 17698563, 15893842, 12958196, 17640975, 18412020, 18395095, 17976157, 17805973, 16248980
Liver Diseases inferred via Carbon Tetrachloride 16246199, 17285989, 15830285, 15720792, 16964402
Liver Failure inferred via Carbon Tetrachloride 15123358
Liver Failure, Acute inferred via Carbon Tetrachloride 14706259, 16899240
Liver Neoplasms, Experimental inferred via Carbon Tetrachloride 15583823
Epilepsies, Partial inferred via Carbamazepine 17116037
Hyperhomocysteinemia inferred via Carbamazepine 10459572
Osteomalacia inferred via Carbamazepine 17016548
Pseudolymphoma inferred via Carbamazepine 9591791, 12752131
Breast Neoplasms inferred via Calcitriol 11237771
Carcinoma, Squamous Cell inferred via Calcitriol 11237771
Encephalomyelitis, Autoimmune, Experimental inferred via Calcitriol 15138306
Prostatic Hyperplasia inferred via Calcitriol 15572423
Prostatic Neoplasms inferred via Calcitriol 12479363, 16644109, 16289102
Esophageal Neoplasms inferred via Benzo(a)pyrene 16530937
Lung Neoplasms inferred via Benzo(a)pyrene 17053015
Urinary Bladder Neoplasms inferred via Benzo(a)pyrene 17053015
Coronary Artery Disease inferred via atorvastatin 16368305
Heart Failure inferred via atorvastatin 16360360
Hyperlipoproteinemia Type II inferred via atorvastatin 16238680
Liver Cirrhosis, Experimental inferred via atorvastatin 17347453
Melanoma inferred via artesunate 16273263
Pancreatitis inferred via artemisinine 17948936
Adenocarcinoma inferred via arsenic trioxide 11798837
Blood Coagulation Disorders inferred via arsenic trioxide 16206674
Burkitt Lymphoma inferred via arsenic trioxide 11589617
Carcinoma, Hepatocellular inferred via arsenic trioxide 16217749, 14691202, 15553829, 15073043, 11135700
Carcinoma, Small Cell inferred via arsenic trioxide 12490120
Coronary Restenosis inferred via arsenic trioxide 12609071
Death, Sudden, Cardiac inferred via arsenic trioxide 15213294
Esophageal Neoplasms inferred via arsenic trioxide 12903497
Fatty Liver inferred via arsenic trioxide 15073043
Gallbladder Neoplasms inferred via arsenic trioxide 16904648
Leukemia inferred via arsenic trioxide 15070760
Leukemia-Lymphoma, Adult T-Cell inferred via arsenic trioxide 12560223, 17077332
Leukemia, Monocytic, Acute inferred via arsenic trioxide 16972261
Leukemia, Myelogenous, Chronic, BCR-ABL Positive inferred via arsenic trioxide 14633726
Leukemia, Myeloid, Acute inferred via arsenic trioxide 16467208, 17050201, 16968895
Leukemia, Promyelocytic, Acute inferred via arsenic trioxide 16891316, 15622746, 12712474, 11468182, 15336539, 16331271, 17217047, 17107899, 15748426, 15213294, 12679006, 11161223, 16966277, 16330433, 16823087
Leukemia, T-Cell inferred via arsenic trioxide 16882451
Liver Neoplasms inferred via arsenic trioxide 14682389
Long QT Syndrome inferred via arsenic trioxide 15213294
Lung Neoplasms inferred via arsenic trioxide 11798837
Multiple Myeloma inferred via arsenic trioxide 15949261, 11468182, 14977855
Myelodysplastic Syndromes inferred via arsenic trioxide 16105982, 16882451
Neoplasm Invasiveness inferred via arsenic trioxide 16624393
Ovarian Neoplasms inferred via arsenic trioxide 16624393, 12452020
Pancreatic Neoplasms inferred via arsenic trioxide 15580305
Sarcoma, Ewing's inferred via arsenic trioxide 16646077
Stomach Neoplasms inferred via arsenic trioxide 17007042
Torsades de Pointes inferred via arsenic trioxide 15213294
Urinary Bladder Neoplasms inferred via arsenic trioxide 12973940, 12845720, 11780464
Arsenic Poisoning inferred via Arsenic 16251483, 12569548, 16835338
Atherosclerosis inferred via Arsenic 12928151
Carcinoma, Basal Cell inferred via Arsenic 15504454
Carcinoma, Hepatocellular inferred via Arsenic 16507464
Carcinoma, Squamous Cell inferred via Arsenic 15504454
Cardiovascular Diseases inferred via Arsenic 15738583
Carotid Artery Diseases inferred via Arsenic 16973168
Foot Diseases inferred via Arsenic 6392382
Hypertension inferred via Arsenic 9931084, 11953799
Keratosis inferred via Arsenic 17050553, 16930632, 12749816
Leukemia, Promyelocytic, Acute inferred via Arsenic 17339181
Liver Diseases inferred via Arsenic 11134558
Liver Neoplasms inferred via Arsenic 16368122
Myocardial Ischemia inferred via Arsenic 15371236
Neural Tube Defects inferred via Arsenic 16620997
Neurogenic Inflammation inferred via Arsenic 17056641
Peripheral Vascular Diseases inferred via Arsenic 15371236, 6392382, 16905509
Prostatic Neoplasms inferred via Arsenic 16140617
Skin Diseases inferred via Arsenic 17050553, 15952646, 16759981, 6392382, 16353154
Skin Neoplasms inferred via Arsenic 16251483, 17050553, 17029826, 15504454
Urinary Bladder Neoplasms inferred via Arsenic 15987713, 11144890
Vascular Diseases inferred via Arsenic 17056641
Hepatitis, Toxic inferred via Acetaminophen 2444490, 17522070, 14986274, 16177239, 15968718, 16227642, 17562736, 16081117
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215
Melanoma inferred via 6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid 17992120
Infertility, Male inferred via 3-dinitrobenzene 16988215
Nerve Degeneration inferred via 3-dinitrobenzene 11301198
Adenoma inferred via 2-Acetylaminofluorene 10737359
Carcinoma, Hepatocellular inferred via 2-Acetylaminofluorene 10737359
Liver Neoplasms inferred via 2-Acetylaminofluorene 10737359, 14678523, 18001218, 16273603, 11376686, 10672840
Lung Neoplasms inferred via 2-Acetylaminofluorene 11376686
Urinary Bladder Neoplasms inferred via 2-Acetylaminofluorene 15867355, 15289314
Cholestasis, Intrahepatic inferred via 1-Naphthylisothiocyanate 10220858
Hepatitis, Toxic inferred via 1-Naphthylisothiocyanate 17522070
Liver Diseases inferred via 1-Naphthylisothiocyanate 17184895

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Tripodi G, et al. (2009) "Steroid biosynthesis and renal excretion in human essential hypertension: association with blood pressure and endogenous ouabain." Am J Hypertens. 22(4):357-363. PMID:19197249
  2. [ + ] Prokopenko O, et al. (2009) "Ischemia-reperfusion-inducible protein modulates cell sensitivity to anticancer drugs by regulating activity of efflux transporter." Am J Physiol Cell Physiol. 296(5):C1086-C1097. PMID:19279227
  3. [ + ] Li QQ, et al. (2009) "The role of P-glycoprotein/cellular prion protein interaction in multidrug-resistant breast cancer cells treated with paclitaxel." Cell Mol Life Sci. 66(3):504-515. PMID:19099191
  4. [ + ] Westerlund M, et al. (2009) "Association of a polymorphism in the ABCB1 gene with Parkinson's disease." Parkinsonism Relat Disord. 15(6):422-424. PMID:19196542
  5. [ + ] Kodaira C, et al. (2009) "Effect of MDR1 C3435T polymorphism on lansoprazole in healthy Japanese subjects." Eur J Clin Pharmacol. 65(6):593-600. PMID:19238367
  6. [ + ] Hosohata K, et al. (2009) "MDR1 haplotypes conferring an increased expression of intestinal CYP3A4 rather than MDR1 in female living-donor liver transplant patients." Pharm Res. 26(7):1590-1595. PMID:19267185
  7. [ + ] Huang WT, et al. (2009) "Expression of the multidrug resistance protein MRP and the lung-resistance protein LRP in nasal NK/T cell lymphoma: further exploring the role of P53 and WT1 gene." Pathology. 41(2):127-132. PMID:18972317
  8. [ + ] Goekkurt E, et al. (2009) "Pharmacogenetic analyses of hematotoxicity in advanced gastric cancer patients receiving biweekly fluorouracil, leucovorin, oxaliplatin and docetaxel (FLOT): a translational study of the Arbeitsgemeinschaft Internistische Onkologie (AIO)." Ann Oncol. 20(3):481-485. PMID:19074750
  9. [ + ] Green H, et al. (2009) "Pharmacogenetic studies of Paclitaxel in the treatment of ovarian cancer." Basic Clin Pharmacol Toxicol. 104(2):130-137. PMID:19143748
  10. [ + ] Guo J, et al. (2009) "Identification of genes that confer tumor cell resistance to the aurora B kinase inhibitor, AZD1152." Pharmacogenomics J. 9(2):90-102. PMID:19188929
  11. [ + ] Mahungu T, et al. (2009) "Cytochrome P450 2B6 516G-->T is associated with plasma concentrations of nevirapine at both 200 mg twice daily and 400 mg once daily in an ethnically diverse population." HIV Med. 10(5):310-317. PMID:19228205
  12. [ + ] Shirasaka Y, et al. (2009) "Expression levels of human P-glycoprotein in in vitro cell lines: correlation between mRNA and protein levels for P-glycoprotein expressed in cells." Biopharm Drug Dispos. 30(3):149-152. PMID:19243013
  13. [ + ] Press RR, et al. (2009) "Explaining variability in tacrolimus pharmacokinetics to optimize early exposure in adult kidney transplant recipients." Ther Drug Monit. 31(2):187-197. PMID:19258929
  14. [ + ] Corich L, et al. (2009) "The cytotoxic effect of unconjugated bilirubin in human neuroblastoma SH-SY5Y cells is modulated by the expression level of MRP1 but not MDR1." Biochem J. 417(1):305-312. PMID:18713069
  15. [ + ] Rebecchi IM, et al. (2009) "ABCB1 and ABCC1 expression in peripheral mononuclear cells is influenced by gene polymorphisms and atorvastatin treatment." Biochem Pharmacol. 77(1):66-75. PMID:18851956
  16. [ + ] Weiss J, et al. (2009) "CYP2C19 genotype is a major factor contributing to the highly variable pharmacokinetics of voriconazole." J Clin Pharmacol. 49(2):196-204. PMID:19033450
  17. [ + ] Guo X, et al. (2009) "No effect of MDR1 C3435T polymorphism on oral pharmacokinetics of telmisartan in 19 healthy Chinese male subjects." Clin Chem Lab Med. 47(1):38-43. PMID:19072027
  18. [ + ] Wang H, et al. (2009) "Genetic susceptibility of lung cancer associated with common variants in the 3' untranslated regions of the adenosine triphosphate-binding cassette B1 (ABCB1) and ABCC1 candidate transporter genes for carcinogen export." Cancer. 115(3):595-607. PMID:19107762
  19. [ + ] Kim DH, et al. (2009) "Genetic variants in the candidate genes of the apoptosis pathway and susceptibility to chronic myeloid leukemia." Blood. 113(11):2517-2525. PMID:19141860
  20. [ + ] Bournissen FG, et al. (2009) "Polymorphism of the MDR1/ABCB1 C3435T drug-transporter and resistance to anticonvulsant drugs: a meta-analysis." Epilepsia. 50(4):898-903. PMID:19178561
  21. [ + ] Delaunay JL, et al. (2009) "A missense mutation in ABCB4 gene involved in progressive familial intrahepatic cholestasis type 3 leads to a folding defect that can be rescued by low temperature." Hepatology. 49(4):1218-1227. PMID:19185004
  22. [ + ] Estrela Rde C, et al. (2009) "ABCB1 polymorphisms and the concentrations of lopinavir and ritonavir in blood, semen and saliva of HIV-infected men under antiretroviral therapy." Pharmacogenomics. 10(2):311-318. PMID:19207033
  23. [ + ] Stockner T, et al. (2009) "Data-driven homology modelling of P-glycoprotein in the ATP-bound state indicates flexibility of the transmembrane domains." FEBS J. 276(4):964-972. PMID:19215299
  24. [ + ] Woo S, et al. (2009) "Population pharmacokinetics of romidepsin in patients with cutaneous T-cell lymphoma and relapsed peripheral T-cell lymphoma." Clin Cancer Res. 15(4):1496-1503. PMID:19228751
  25. [ + ] Enquist K, et al. (2009) "Membrane-integration characteristics of two ABC transporters, CFTR and P-glycoprotein." J Mol Biol. 387(5):1153-1164. PMID:19236881
  26. [ + ] Krivulcik T, et al. (2009) "Frequency of the three most common polymorphisms in the MDR1 gene in Slovak population." Neoplasma. 56(2):101-107. PMID:19239322
  27. [ + ] Haas DW, et al. (2009) "Associations between CYP2B6 polymorphisms and pharmacokinetics after a single dose of nevirapine or efavirenz in African americans." J Infect Dis. 199(6):872-880. PMID:19239339
  28. [ + ] Funke C, et al. (2009) "Genetic analysis of coding SNPs in blood-brain barrier transporter MDR1 in European Parkinson's disease patients." J Neural Transm. 116(4):443-450. PMID:19255821
  29. [ + ] Jamroziak K, et al. (2009) "Polymorphisms and haplotypes in the multidrug resistance 1 gene (MDR1/ABCB1) and risk of multiple myeloma." Leuk Res. 33(2):332-335. PMID:18639335
  30. [ + ] Kawasaki K, et al. (2009) "REIC/Dkk-3 overexpression downregulates P-glycoprotein in multidrug-resistant MCF7/ADR cells and induces apoptosis in breast cancer." Cancer Gene Ther. 16(1):65-72. PMID:18654608
  31. [ + ] D'Addabbo A, et al. (2009) "Association of genetic profiles to Crohn's disease by linear combinations of single nucleotide polymorphisms." Artif Intell Med. 46(2):131-138. PMID:18804983
  32. [ + ] Miura M, et al. (2009) "Telmisartan pharmacokinetics in Japanese renal transplant recipients." Clin Chim Acta. 399(1-2):83-87. PMID:18838068
  33. [ + ] Ruano G, et al. (2009) "Physiogenomic comparison of edema and BMI in patients receiving rosiglitazone or pioglitazone." Clin Chim Acta. 400(1-2):48-55. PMID:18996102
  34. [ + ] Juyal G, et al. (2009) "Associations between common variants in the MDR1 (ABCB1) gene and ulcerative colitis among North Indians." Pharmacogenet Genomics. 19(1):77-85. PMID:19005421
  35. [ + ] Giraud C, et al. (2009) "High levels of P-glycoprotein activity in human lymphocytes in the first 6 months of life." Clin Pharmacol Ther. 85(3):289-295. PMID:19037199
  36. [ + ] Dahan A, et al. (2009) "Grapefruit juice and its constituents augment colchicine intestinal absorption: potential hazardous interaction and the role of p-glycoprotein." Pharm Res. 26(4):883-892. PMID:19048359
  37. [ + ] Tanaka S, et al. (2009) "P-glycoprotein function in peripheral T lymphocyte subsets of myasthenia gravis patients: clinical implications and influence of glucocorticoid administration." Int Immunopharmacol. 9(3):284-290. PMID:19101657
  38. [ + ] Simon T, et al. (2009) "Genetic determinants of response to clopidogrel and cardiovascular events." N Engl J Med. 360(4):363-375. PMID:19106083
  39. [ + ] Krupoves A, et al. (2009) "Associations between ABCB1/MDR1 gene polymorphisms and Crohn's disease: a gene-wide study in a pediatric population." Inflamm Bowel Dis. 15(6):900-908. PMID:19107781
  40. [ + ] Kwon WS, et al. (2009) "G-T haplotype (2677G>T/A and 3435C>T) of ABCB1 gene polymorphisms is associated with ethnic differences to paclitaxel sensitivity in cancer cells with different gene expression pattern." Cancer Lett. 277(2):155-163. PMID:19138818
  41. [ + ] Kim DW, et al. (2009) "Lack of association between ABCB1, ABCG2, and ABCC2 genetic polymorphisms and multidrug resistance in partial epilepsy." Epilepsy Res. 84(1):86-90. PMID:19167193
  42. [ + ] Oretti C, et al. (2009) "Glutathione-S-transferase-P1 I105V polymorphism and response to antenatal betamethasone in the prevention of respiratory distress syndrome." Eur J Clin Pharmacol. 65(5):483-491. PMID:19183974
  43. [ + ] Zschiedrich K, et al. (2009) "MDR1 variants and risk of Parkinson disease. Association with pesticide exposure?" J Neurol. 256(1):115-120. PMID:19184162
  44. [ + ] Kim HS, et al. (2009) "Genetic polymorphisms affecting clinical outcomes in epithelial ovarian cancer patients treated with taxanes and platinum compounds: a Korean population-based study." Gynecol Oncol. 113(2):264-269. PMID:19203783
  45. [ + ] Zhao Y, et al. (2009) "Effects of CYP3A5, MDR1 and CACNA1C polymorphisms on the oral disposition and response of nimodipine in a Chinese cohort." Eur J Clin Pharmacol. 65(6):579-584. PMID:19205682
  46. [ + ] Lovas K, et al. (2009) "Glucocorticoid replacement therapy and pharmacogenetics in Addison's disease: effects on bone." Eur J Endocrinol. 160(6):993-1002. PMID:19282465
  47. [ + ] De Luca V, et al. (2009) "MDR1 gene in tardive dyskinesia scale scores: comparison of strategies for quantitative trait haplotype analysis." Schizophr Res. 110(1-3):200-201. PMID:19282152