ABCA13 | GeneID:522756 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 522756 Official Symbol ABCA13
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family A (ABC1), member 13
Chromosome N/A
Also Known As ATP binding cassette, sub-family A (ABC1), member 13
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 27991

ID Symbol Protein Species
GeneID:154664 ABCA13 NP_689914.2 Homo sapiens
GeneID:268379 Abca13 NP_839990.2 Mus musculus
GeneID:289797 Abca13 XP_223625.4 Rattus norvegicus
GeneID:463404 ABCA13 XP_519092.2 Pan troglodytes
GeneID:522756 ABCA13 XP_601044.3 Bos taurus
GeneID:606966 ABCA13 XP_848555.1 Canis lupus familiaris

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0031177 Function phosphopantetheine binding

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_601044 XP_601044

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000034269 MI0005005 bta-miR-106 AAAAGUGCUUACAGUGCAGGUA
ENSBTAT00000034269 MI0004754 bta-miR-126 CGUACCGUGAGUAAUAAUGCG
ENSBTAT00000034269 MI0004754 bta-miR-126* CAUUAUUACUUUUGGUACGCG
ENSBTAT00000034269 MI0005031 bta-miR-17-5p CAAAGUGCUUACAGUGCAGGUAGU
ENSBTAT00000034269 MI0004741 bta-miR-20a UAAAGUGCUUAUAGUGCAGGUAG
ENSBTAT00000034269 MI0005015 bta-miR-20b CAAAGUGCUCACAGUGCAGGUA
ENSBTAT00000034269 MI0005042 bta-miR-23a AUCACAUUGCCAGGGAUUUCCA
ENSBTAT00000034269 MI0004751 bta-miR-99a AACCCGUAGAUCCGAUCUUGU
ENSBTAT00000034269 MI0000272 hsa-miR-182 UUUGGCAAUGGUAGAACUCACACU
ENSBTAT00000034269 MI0000274 hsa-miR-187 UCGUGUCUUGUGUUGCAGCCGG
ENSBTAT00000034269 MI0005570 hsa-miR-208b AUAAGACGAACAAAAGGUUUGU
ENSBTAT00000034269 MI0000791 hsa-miR-383 AGAUCAGAAGGUGAUUGUGGCU
ENSBTAT00000034269 MI0003123 hsa-miR-488 UUGAAAGGCUAUUUCUUGGUC
ENSBTAT00000034269 MI0003159 hsa-miR-518c CAAAGCGCUUCUCUUUAGAGUGU
ENSBTAT00000034269 MI0003171 hsa-miR-518d-3p CAAAGCGCUUCCCUUUGGAGC
ENSBTAT00000034269 MI0003171 hsa-miR-518d-5p CUCUAGAGGGAAGCACUUUCUG
ENSBTAT00000034269 MI0003169 hsa-miR-518e AAAGCGCUUCCCUUCAGAGUG
ENSBTAT00000034269 MI0003162 hsa-miR-519d CAAAGUGCCUCCCUUUAGAGUG
ENSBTAT00000034269 MI0003166 hsa-miR-520g ACAAAGUGCUUCCCUUUAGAGUGU
ENSBTAT00000034269 MI0003585 hsa-miR-578 CUUCUUGUGCUCUAGGAUUGU
ENSBTAT00000034269 MI0003635 hsa-miR-621 GGCUAGCAACAGCGCUUACCU
ENSBTAT00000034269 MI0003638 hsa-miR-624 CACAAGGUAUUGGUAUUACCU
ENSBTAT00000034269 MI0000388 mmu-miR-290-3p AAAGUGCCGCCUAGUUUUAAGCCC
ENSBTAT00000034269 MI0000390 mmu-miR-292-3p AAAGUGCCGCCAGGUUUUGAGUGU
ENSBTAT00000034269 MI0002402 mmu-miR-467a UAAGUGCCUGCAUGUAUAUGCG
ENSBTAT00000034269 MI0004671 mmu-miR-467b GUAAGUGCCUGCAUGUAUAUG
ENSBTAT00000034269 MI0004650 mmu-miR-686 AUUGCUUCCCAGACGGUGAAGA
ENSBTAT00000034269 MI0005206 mmu-miR-742 GAAAGCCACCAUGCUGGGUAAA
ENSBTAT00000034269 MI0005207 mmu-miR-743a GAAAGACACCAAGCUGAGUAGA
ENSBTAT00000034269 MI0005470 mmu-miR-743b-5p UGUUCAGACUGGUGUCCAUCA
ENSBTAT00000034269 MI0004310 mmu-miR-764-3p AGGAGGCCAUAGUGGCAACUGU
ENSBTAT00000034269 MI0004310 mmu-miR-764-5p GGUGCUCACAUGUCCUCCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_601044  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene