A2BP1 | GeneID:521304 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 521304 Official Symbol A2BP1
Locus N/A Gene Type protein-coding
Synonyms MGC140727
Full Name N/A
Description ataxin 2-binding protein 1
Chromosome N/A
Also Known As
Summary N/A

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0005634 Component nucleus
GO:0003676 Function nucleic acid binding
GO:0000166 Function nucleotide binding
GO:0003723 Function RNA binding
GO:0006397 Process mRNA processing
GO:0008380 Process RNA splicing

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001075818 NP_001069286

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000009490 MI0005007 bta-miR-10a UACCCUGUAGAUCCGAAUUUGUG
ENSBTAT00000009490 MI0005052 bta-miR-10b UACCCUGUAGAACCGAAUUUGUG
ENSBTAT00000009490 MI0005069 bta-miR-363 AUUGCACGGUAUCCAUCUGCG
ENSBTAT00000009490 MI0003563 hsa-miR-557 GUUUGCACGGGUGGGCCUUGUCU
ENSBTAT00000009490 MI0003616 hsa-miR-603 CACACACUGCAAUUACUUUUGC
ENSBTAT00000009490 MI0005528 hsa-miR-892a CACUGUGUCCUUUCUGCGUAG
ENSBTAT00000009490 MI0005507 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENSBTAT00000009490 MI0005508 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENSBTAT00000009490 MI0005509 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENSBTAT00000009490 MI0005511 mmu-miR-466h UGUGUGCAUGUGCUUGUGUGUA
ENSBTAT00000009490 MI0005003 mmu-miR-676 CCGUCCUGAGGUUGUUGAGCU
ENSBTAT00000009490 MI0004691 mmu-miR-707 CAGUCAUGCCGCUUGCCUACG
ENSBTAT00000009490 MI0004698 mmu-miR-713 UGCACUGAAGGCACACAGC
ENSBTAT00000009490 MI0004700 mmu-miR-715 CUCCGUGCACACCCCCGCGUG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Harhay GP, et al. (2005) "Characterization of 954 bovine full-CDS cDNA sequences." BMC Genomics. 6():166. PMID:16305752
  2. [ + ] Smith TP, et al. (2001) "Sequence evaluation of four pooled-tissue normalized bovine cDNA libraries and construction of a gene index for cattle." Genome Res. 11(4):626-630. PMID:11282978