ABCC2 | GeneID:520925 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 520925 Official Symbol ABCC2
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family C (CFTR/MRP), member 2
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 68052

ID Symbol Protein Species
GeneID:1244 ABCC2 NP_000383.1 Homo sapiens
GeneID:12780 Abcc2 NP_038834.2 Mus musculus
GeneID:393561 abcc2 NP_956883.1 Danio rerio
GeneID:403632 ABCC2 NP_001003081.1 Canis lupus familiaris
GeneID:423828 ABCC2 XP_421698.2 Gallus gallus
GeneID:450670 ABCC2 XP_507976.2 Pan troglodytes
GeneID:520925 ABCC2 XP_599177.3 Bos taurus
GeneID:818031 ATMRP2 NP_181013.1 Arabidopsis thaliana
GeneID:839920 ATMRP1 NP_001031116.1 Arabidopsis thaliana
GeneID:4337027 Os04g0620000 NP_001053904.1 Oryza sativa

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_599177 XP_599177

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000047274 MI0005048 bta-miR-450 UUUUGCGAUGUGUUCCUAAUAU
ENSBTAT00000047274 MI0000486 hsa-miR-190 UGAUAUGUUUGAUAUAUUAGGU
ENSBTAT00000047274 MI0005545 hsa-miR-190b UGAUAUGUUUGAUAUUGGGUU
ENSBTAT00000047274 MI0002466 hsa-miR-376b AUCAUAGAGGAAAAUCCAUGUU
ENSBTAT00000047274 MI0003134 hsa-miR-494 UGAAACAUACACGGGAAACCUC
ENSBTAT00000047274 MI0003135 hsa-miR-495 AAACAAACAUGGUGCACUUCUU
ENSBTAT00000047274 MI0003163 hsa-miR-521 AACGCACUUCCCUUUAGAGUGU
ENSBTAT00000047274 MI0003176 hsa-miR-521 AACGCACUUCCCUUUAGAGUGU
ENSBTAT00000047274 MI0003565 hsa-miR-559 UAAAGUAAAUAUGCACCAAAA
ENSBTAT00000047274 MI0003616 hsa-miR-603 CACACACUGCAAUUACUUUUGC
ENSBTAT00000047274 MI0003642 hsa-miR-628-3p UCUAGUAAGAGUGGCAGUCGA
ENSBTAT00000047274 MI0000098 hsa-miR-96 UUUGGCACUAGCACAUUUUUGCU
ENSBTAT00000047274 MI0000630 mmu-miR-344 UGAUCUAGCCAAAGCCUGACUGU
ENSBTAT00000047274 MI0005495 mmu-miR-344 UGAUCUAGCCAAAGCCUGACUGU
ENSBTAT00000047274 MI0000640 mmu-miR-350 UUCACAAAGCCCAUACACUUUC
ENSBTAT00000047274 MI0002398 mmu-miR-463 UGAUAGACACCAUAUAAGGUAG
ENSBTAT00000047274 MI0005546 mmu-miR-466d-3p UAUACAUACACGCACACAUAG
ENSBTAT00000047274 MI0003523 mmu-miR-547 CUUGGUACAUCUUUGAGUGAG
ENSBTAT00000047274 MI0004310 mmu-miR-764-5p GGUGCUCACAUGUCCUCCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_599177  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene