AASS | GeneID:520865 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 520865 Official Symbol AASS
Locus N/A Gene Type protein-coding
Synonyms MGC166100
Full Name N/A
Description aminoadipate-semialdehyde synthase
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 4212

ID Symbol Protein Species
GeneID:10157 AASS NP_005754.2 Homo sapiens
GeneID:30956 Aass NP_038958.2 Mus musculus
GeneID:34064 CG7144 NP_609150.2 Drosophila melanogaster
GeneID:176842 dehydrogenase NP_499884.1 Caenorhabditis elegans
GeneID:296925 Aass XP_231524.4 Rattus norvegicus
GeneID:417757 AASS XP_416001.2 Gallus gallus
GeneID:472493 AASS XP_527868.2 Pan troglodytes
GeneID:482429 AASS XP_539546.2 Canis lupus familiaris
GeneID:520865 AASS XP_599115.3 Bos taurus
GeneID:556229 aass XP_684074.3 Danio rerio
GeneID:855786 LYS9 NP_014448.1 Saccharomyces cerevisiae
GeneID:1275481 AgaP_AGAP008632 XP_314728.2 Anopheles gambiae
GeneID:2540908 SPBC3B8.03 NP_596411.1 Schizosaccharomyces pombe
GeneID:2678741 MGG_08564 XP_362873.1 Magnaporthe grisea
GeneID:2704923 NCU03748.1 XP_323050.1 Neurospora crassa
GeneID:2892518 KLLA0C18744g XP_453035.1 Kluyveromyces lactis

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005739 Component mitochondrion
GO:0005488 Function binding
GO:0009055 Function electron carrier activity
GO:0016491 Function oxidoreductase activity
GO:0047131 Function saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity
GO:0047130 Function saccharopine dehydrogenase (NADP+, L-lysine-forming) activity
GO:0019477 Process L-lysine catabolic process
GO:0055114 Process oxidation reduction

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001109797 NP_001103267

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000016090 MI0004754 bta-miR-126* CAUUAUUACUUUUGGUACGCG
ENSBTAT00000016090 MI0005033 bta-miR-186 CAAAGAAUUCUCCUUUUGGGCU
ENSBTAT00000016090 MI0005042 bta-miR-23a AUCACAUUGCCAGGGAUUUCCA
ENSBTAT00000016090 MI0005066 bta-miR-23b AUCACAUUGCCAGGGAUUACCAC
ENSBTAT00000016090 MI0004748 bta-miR-320 AAAAGCUGGGUUGAGAGGGCGA
ENSBTAT00000016090 MI0005047 bta-miR-425-3p AUCGGGAAUGUCGUGUCCGCCC
ENSBTAT00000016090 MI0000816 hsa-miR-335 UCAAGAGCAAUAACGAAAAAUGU
ENSBTAT00000016090 MI0001145 hsa-miR-384 AUUCCUAGAAAUUGUUCAUA
ENSBTAT00000016090 MI0003146 hsa-miR-520f AAGUGCUUCCUUUUAGAGGGUU
ENSBTAT00000016090 MI0003573 hsa-miR-567 AGUAUGUUCUUCCAGGACAGAAC
ENSBTAT00000016090 MI0005507 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSBTAT00000016090 MI0005508 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSBTAT00000016090 MI0005509 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSBTAT00000016090 MI0005470 mmu-miR-743b-5p UGUUCAGACUGGUGUCCAUCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene