ACP1 | GeneID:52 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 52 Official Symbol ACP1
Locus N/A Gene Type protein-coding
Synonyms HAAP; MGC111030; MGC3499
Full Name acid phosphatase 1, soluble
Description acid phosphatase 1, soluble
Chromosome 2p25
Also Known As acid phosphatase of erythrocyte; adipocyte acid phosphatase; cytoplasmic phosphotyrosyl protein phosphatase; low molecular weight phosphotyrosine protein phosphatase; protein tyrosine phosphatase; red cell acid phosphatase 1
Summary The product of this gene belongs to the phosphotyrosine protein phosphatase family of proteins. It functions as an acid phosphatase and a protein tyrosine phosphatase by hydrolyzing protein tyrosine phosphate to protein tyrosine and orthophosphate. This enzyme also hydrolyzes orthophosphoric monoesters to alcohol and orthophosphate. This gene is genetically polymorphic, and three common alleles segregating at the corresponding locus give rise to six phenotypes. Each allele appears to encode at least two electrophoretically different isozymes, Bf and Bs, which are produced in allele-specific ratios. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 38274

ID Symbol Protein Species
GeneID:52 ACP1 NP_009030.1 Homo sapiens
GeneID:11431 Acp1 NP_067305.2 Mus musculus
GeneID:24161 Acp1 NP_067085.1 Rattus norvegicus
GeneID:280977 ACP1 NP_776403.1 Bos taurus
GeneID:421909 ACP1 NP_001034380.1 Gallus gallus
GeneID:458990 ACP1 XP_001149653.1 Pan troglodytes
GeneID:541489 zgc:110844 NP_001014324.1 Danio rerio
GeneID:785845 ACP1 XP_001252562.1 Bos taurus
GeneID:823588 AT3G44620 NP_190048.2 Arabidopsis thaliana
GeneID:856187 LTP1 NP_015398.1 Saccharomyces cerevisiae
GeneID:2675516 MGG_04942 XP_359835.2 Magnaporthe grisea
GeneID:2712669 NCU09841.1 XP_330763.1 Neurospora crassa
GeneID:2897338 KLLA0B09174g XP_451937.1 Kluyveromyces lactis
GeneID:3361433 stp1 NP_001018265.1 Schizosaccharomyces pombe
GeneID:3772179 primo-1 NP_001027188.1 Drosophila melanogaster
GeneID:4346297 Os08g0557400 NP_001062484.1 Oryza sativa
GeneID:4619866 AGOS_ADL365W NP_983731.1 Eremothecium gossypii

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab54720 Acid Phosphatase antibody (ab54720); Mouse monoclonal to Acid Phosphatase
2 abcam ab26232 Acid Phosphatase antibody (ab26232); Sheep polyclonal to Acid Phosphatase
3 abcam ab47784 Acid Phosphatase antibody (ab47784); Chicken polyclonal to Acid Phosphatase
4 abcam ab58688 Acid Phosphatase antibody (ab58688); Rabbit polyclonal to Acid Phosphatase
5 abgent AP8441a LMW-PTP Antibody; Purified Rabbit Polyclonal Antibody (Pab)
6 abnova H00000052-M06 ACP1 monoclonal antibody (M06), clone 2A3; Mouse monoclonal antibody raised against a full-length recombinant ACP1.
7 abnova H00000052-M01 ACP1 monoclonal antibody (M01), clone 4B10; Mouse monoclonal antibody raised against a full length recombinant ACP1.
8 acris AP15256PU-N ACP1 / LMW-PTPase; antibody Ab
9 acris AP05058PU-N ACP1 / LMW-PTPase; antibody
10 scbt ACP1 ACP1 Antibody / ACP1 Antibodies;
11 sigma HPA016754 Anti-ACP1 antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of ACP1 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ACP1 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0005625 Component soluble fraction
GO:0003993 Function acid phosphatase activity
GO:0016787 Function hydrolase activity
GO:0042802 Function identical protein binding
GO:0004726 Function non-membrane spanning protein tyrosine phosphatase activity
GO:0006470 Process protein amino acid dephosphorylation

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001040649  UCSC Browser NP_001035739
2 NM_004300  UCSC Browser NP_004291 P24666   Q59EH3  
3 NM_007099  UCSC Browser NP_009030 A8K1L9   P24666  
4 NR_024080  UCSC Browser

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000272065 MI0000809 hsa-miR-151-3p CUAGACUGAAGCUCCUUGAGG
ENST00000272065 MI0000286 hsa-miR-210 CUGUGCGUGUGACAGCGGCUGA
ENST00000272065 MI0000086 hsa-miR-28-3p CACUAGAUUGUGAGCUCCUGGA
ENST00000272065 MI0000762 hsa-miR-362-3p AACACACCUAUUCAAGGAUUCA
ENST00000272065 MI0000789 hsa-miR-381 UAUACAAGGGCAAGCUCUCUGU
ENST00000272065 MI0003123 hsa-miR-488* CCCAGAUAAUGGCACUCUCAA
ENST00000272065 MI0003159 hsa-miR-518c CAAAGCGCUUCUCUUUAGAGUGU
ENST00000272065 MI0003581 hsa-miR-574-5p UGAGUGUGUGUGUGUGAGUGUGU
ENST00000272065 MI0003640 hsa-miR-626 AGCUGUCUGAAAAUGUCUU
ENST00000272065 MI0005543 hsa-miR-708* CAACUAGACUGUGAGCUUCUAG
ENST00000272065 MI0005507 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENST00000272065 MI0005508 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENST00000272065 MI0005509 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENST00000272065 MI0005511 mmu-miR-466h UGUGUGCAUGUGCUUGUGUGUA
ENST00000272065 MI0005470 mmu-miR-743b-5p UGUUCAGACUGGUGUCCAUCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Cadmium
  • Cadmium results in increased expression of ACP1 mRNA
17327700
Cadmium Chloride
  • Cadmium Chloride results in increased expression of ACP1 mRNA
17327700
Ethinyl Estradiol
  • Ethinyl Estradiol results in increased expression of ACP1 mRNA
17555576
Paraquat
  • Paraquat results in decreased expression of ACP1 mRNA
15458575
Tamoxifen
  • Tamoxifen affects the expression of ACP1 mRNA
17555576
Tunicamycin
  • Tunicamycin results in increased expression of ACP1 mRNA
15458575

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Breast Neoplasms inferred via Tamoxifen 16202921, 15565566, 17242785, 16818667, 17049068, 17893378, 15668708, 17440819, 17261762, 16873071, 11161223
Carcinoma, Hepatocellular inferred via Tamoxifen 16924424
Carcinoma, Transitional Cell inferred via Tamoxifen 17572228
Endometrial Neoplasms inferred via Tamoxifen 16202921, 17893378
Fatty Liver inferred via Tamoxifen 14986274
Female Urogenital Diseases inferred via Tamoxifen 16709447
Lipidoses inferred via Tamoxifen 15342952
Liver Cirrhosis, Experimental inferred via Tamoxifen 18564211
Liver Neoplasms inferred via Tamoxifen 16684651
Mammary Neoplasms, Experimental inferred via Tamoxifen 11731420, 14580682, 16827153
Melanoma inferred via Tamoxifen 12393984
Melanoma, Amelanotic inferred via Tamoxifen 15990972
Spermatocele inferred via Tamoxifen 16709447
Urinary Bladder Neoplasms inferred via Tamoxifen 16712894, 17572228
Agricultural Workers' Diseases inferred via Paraquat 11874814
Gliosis inferred via Paraquat 11124998
Nerve Degeneration inferred via Paraquat 16893418
Parkinson Disease inferred via Paraquat 12911755, 15824117, 11445065, 11124998, 16140633, 11181820, 16510128, 15451049
Pneumonia inferred via Paraquat 12504350
Pulmonary Fibrosis inferred via Paraquat 16324872, 17997886
Respiratory Distress Syndrome, Adult inferred via Paraquat 11700416
Respiratory Sounds inferred via Paraquat 11874814
Retinal Degeneration inferred via Paraquat 16458197
Acne Vulgaris inferred via Ethinyl Estradiol 17505938
Adenocarcinoma inferred via Ethinyl Estradiol 14692618
Arteriosclerosis inferred via Ethinyl Estradiol 11256880
Arthritis, Experimental inferred via Ethinyl Estradiol 15885639
Cholestasis inferred via Ethinyl Estradiol 17110522, 15861022, 11677210, 16105132, 16919318, 17333356, 17681005
Encephalomyelitis, Autoimmune, Experimental inferred via Ethinyl Estradiol 12538720
Fatty Liver inferred via Ethinyl Estradiol 15345470
Hypospadias inferred via Ethinyl Estradiol 16569931, 16945680
Infertility, Female inferred via Ethinyl Estradiol 12013081
Infertility, Male inferred via Ethinyl Estradiol 17937319
Panic Disorder inferred via Ethinyl Estradiol 11578682
Pruritus inferred via Ethinyl Estradiol 16919318, 15861022
Spermatocele inferred via Ethinyl Estradiol 16709447
Thrombophilia inferred via Ethinyl Estradiol 11994571
Thrombosis inferred via Ethinyl Estradiol 15669648
Uterine Neoplasms inferred via Ethinyl Estradiol 14692618
Venous Thrombosis inferred via Ethinyl Estradiol 15869587
Kidney Diseases inferred via Cadmium Chloride 16962696
Cell Transformation, Neoplastic inferred via Cadmium 17332340
Kidney Diseases inferred via Cadmium 16962696, 16322080
Prostatic Neoplasms inferred via Cadmium 17075824

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
CTNNB1 CTNNB1 / ACP1 Co-localization Taddei ML (2002)
EPHA2 ACP1 / EPHA2 Affinity Capture-Western Kikawa KD (2002)
EPHA2 EPHA2 / ACP1 Affinity Capture-Western Kikawa KD (2002)
EPHA2 ACP1 / EPHA2 Biochemical Activity Kikawa KD (2002)
EPHB1 EPHB1 / ACP1 Affinity Capture-Western Stein E (1998)
EPHB1 EPHB1 / ACP1 Reconstituted Complex Stein E (1998)
EPHB2 EPHB2 / ACP1 Affinity Capture-Western Stein E (1998)
FNBP1L ACP1 / FNBP1L Two-hybrid Stelzl U (2005)
KDR KDR / ACP1 Two-hybrid Huang L (1999)
MRPL20 ACP1 / MRPL20 Two-hybrid Stelzl U (2005)
SFMBT1 ACP1 / SFMBT1 Two-hybrid Rual JF (2005)
ZAP70 ZAP70 / ACP1 Affinity Capture-Western Bottini N (2002)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] De Lorenzo A, et al. (2009) "A study of acid phosphatase locus 1 in women with high fat content and normal body mass index." Metabolism. 58(3):351-354. PMID:19217450
  2. [ + ] Banci M, et al. (2009) "ACP1 genetic polymorphism and coronary artery disease: an association study." Cardiology. 113(4):236-242. PMID:19246900
  3. [ + ] Ammendola ML, et al. (2008) "Is there an association between uterine leiomyomas and acid phosphatase locus 1 polymorphism?" Am J Obstet Gynecol. ():. PMID:18992867
  4. [ + ] Gloria-Bottini F, et al. (2008) "Feto-maternal ACP1 activity ratio and intrauterine survival." Eur J Obstet Gynecol Reprod Biol. 140(1):12-16. PMID:16762482
  5. [ + ] Spina C, et al. (2008) "ACP1 genetic polymorphism and colon cancer." Cancer Genet Cytogenet. 186(1):61-62. PMID:18786445
  6. [ + ] Gloria-Bottini F, et al. (2008) "The genetics of feto-placental development: a study of acid phosphatase locus 1 and adenosine deaminase polymorphisms in a consecutive series of newborn infants." Reprod Biol Endocrinol. 6():38. PMID:18768081
  7. [ + ] Esteves Martins Mde F, et al. (2008) "[Genetic polymorphisms of low molecular weight protein tyrosine phosphatase (LMW-PTP): relationship with erythrocyte enzymatic phenotype in patients with Systemic Lupus Erythematosus]" Acta Reumatol Port. 33(2):177-187. PMID:18604186
  8. [ + ] Ammendola M, et al. (2008) "Acid phosphatase locus 1 genetic polymorphism, endometriosis, and allergy." Fertil Steril. 90(4):1203-1205. PMID:18490013
  9. [ + ] Alho I, et al. (2008) "Low molecular weight protein tyrosine phosphatase genetic polymorphism and susceptibility to cancer development." Cancer Genet Cytogenet. 181(1):20-24. PMID:18262048
  10. [ + ] Greco E, et al. (2008) "Skin testing correlates negatively with high-activity ACP1 *B/*C genotype." Int Arch Allergy Immunol. 145(1):48-53. PMID:17703100
  11. [ + ] Gloria-Bottini F, et al. (2008) "The effects of genetic and seasonal factors on reproductive success." Fertil Steril. 89(5):1090-1094. PMID:17678914
  12. [ + ] Nicotra M, et al. (2007) "Repeated spontaneous abortion. Cooperative effects of ADA and ACP1 genetic polymorphisms." Am J Reprod Immunol. 58(1):1-10. PMID:17565542
  13. [ + ] Fortpied J, et al. (2007) "Identification of protein-ribulosamine-5-phosphatase as human low-molecular-mass protein tyrosine phosphatase-A." Biochem J. 406(1):139-145. PMID:17472574
  14. [ + ] Bottini E, et al. (2007) "Allergy and ACP1 genetic polymorphism." Allergy Asthma Proc. 28(1):87-92. PMID:17390764
  15. [ + ] Ewing RM, et al. (2007) "Large-scale mapping of human protein-protein interactions by mass spectrometry." Mol Syst Biol. 3():89. PMID:17353931
  16. [ + ] Yoon DY, et al. (2007) "Dopaminergic polymorphisms in Tourette syndrome: association with the DAT gene (SLC6A3)." Am J Med Genet B Neuropsychiatr Genet. 144B(5):605-610. PMID:17171650
  17. [ + ] Gloria-Bottini F, et al. (2007) "ACP1 and offspring sex ratio in smoking puerperae: a study at population level." Early Hum Dev. 83(6):349-354. PMID:16973312
  18. [ + ] Kanda M, et al. (2006) "Glutaredoxin modulates platelet-derived growth factor-dependent cell signaling by regulating the redox status of low molecular weight protein-tyrosine phosphatase." J Biol Chem. 281(39):28518-28528. PMID:16893901
  19. [ + ] Kimura K, et al. (2006) "Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes." Genome Res. 16(1):55-65. PMID:16344560
  20. [ + ] Zabell AP, et al. (2006) "Crystal structure of the human B-form low molecular weight phosphotyrosyl phosphatase at 1.6-A resolution." J Biol Chem. 281(10):6520-6527. PMID:16253994
  21. [ + ] Zhang Y, et al. (2005) "Time-resolved mass spectrometry of tyrosine phosphorylation sites in the epidermal growth factor receptor signaling network reveals dynamic modules." Mol Cell Proteomics. 4(9):1240-1250. PMID:15951569
  22. [ + ] Bottini N, et al. (2005) "Risk of type 1 diabetes in childhood and maternal age at delivery, interaction with ACP1 and sex." Diabetes Metab Res Rev. 21(4):353-358. PMID:15586390
  23. [ + ] Rual JF, et al. (2005) "Towards a proteome-scale map of the human protein-protein interaction network." Nature. 437(7062):1173-1178. PMID:16189514
  24. [ + ] Stelzl U, et al. (2005) "A human protein-protein interaction network: a resource for annotating the proteome." Cell. 122(6):957-968. PMID:16169070
  25. [ + ] Malentacchi F, et al. (2005) "Up-regulated expression of low molecular weight protein tyrosine phosphatases in different human cancers." Biochem Biophys Res Commun. 334(3):875-883. PMID:16036221
  26. [ + ] Iannaccone U, et al. (2005) "Serum glucose concentration and ACP1 genotype in healthy adult subjects." Metabolism. 54(7):891-894. PMID:15988697
  27. [ + ] Bottini N, et al. (2005) "Genetic polymorphism and TH1/TH2 orientation." Int Arch Allergy Immunol. 138(4):328-333. PMID:16224193
  28. [ + ] Bottini N, et al. (2004) "Maternal cigarette smoking, metabolic enzyme polymorphism, and developmental events in the early stages of extrauterine life." Hum Biol. 76(2):289-297. PMID:15359537
  29. [ + ] Wilder JA, et al. (2004) "European ACP1*C allele has recessive deleterious effects on early life viability." Hum Biol. 76(6):817-835. PMID:15974295
  30. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  31. [ + ] Krylov MIu, et al. (2004) "[Allele polymorphism of alkaline phosphatase, acid soluble phosphatase, and vitamin D-binding protein genes in postmenopausal osteoporosis]" Ter Arkh. 76(5):61-65. PMID:15230135
  32. [ + ] Bottini N, et al. (2004) "Type 2 diabetes and the genetics of signal transduction: a study of interaction between adenosine deaminase and acid phosphatase locus 1 polymorphisms." Metabolism. 53(8):995-1001. PMID:15281007
  33. [ + ] Sergeev AS, et al. (2003) "[The use of discrete characters in discriminant analysis for diagnosis of pulmonary tuberculosis and for classification of patients differing in treatment efficiency based on polymorphisms at nine codominant loci-HP, GC, TF, PI, PGM1, GLO1, C3, ACP1 and ESD]" Genetika. 39(7):996-1002. PMID:12942785
  34. [ + ] Meloni G, et al. (2003) "Association of the ACP1 genotype with metabolic parameters upon initial diagnosis of type 1 diabetes." Med Sci Monit. 9(3):CR105-CR108. PMID:12640337
  35. [ + ] Giannoni E, et al. (2003) "Lymphocyte function-associated antigen-1-mediated T cell adhesion is impaired by low molecular weight phosphotyrosine phosphatase-dependent inhibition of FAK activity." J Biol Chem. 278(38):36763-36776. PMID:12815062
  36. [ + ] Rigacci S, et al. (2003) "LMW-PTP associates and dephosphorylates STAT5 interacting with its C-terminal domain." Biochem Biophys Res Commun. 312(2):360-366. PMID:14637146
  37. [ + ] Bottini N, et al. (2002) "Genotypes of cytosolic low-molecular-weight protein-tyrosine-phosphatase correlate with age at onset of type 1 diabetes in a sex-specific manner." Metabolism. 51(4):419-422. PMID:11912546
  38. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  39. [ + ] Taddei ML, et al. (2002) "Beta-catenin interacts with low-molecular-weight protein tyrosine phosphatase leading to cadherin-mediated cell-cell adhesion increase." Cancer Res. 62(22):6489-6499. PMID:12438242
  40. [ + ] Faggioni G, et al. (2002) "Identification of two SNPs in the 5' flanking region of the ACP1 gene and evaluation of disequilibrium among polymorphic sites." Ann Hum Genet. 66(Pt 4):245-254. PMID:12418966
  41. [ + ] Bottini N, et al. (2002) "Association of the acid phosphatase (ACP1) gene with triglyceride levels in obese women." Mol Genet Metab. 77(3):226-229. PMID:12409270
  42. [ + ] Bottini N, et al. (2002) "Association between the low molecular weight cytosolic acid phosphatase gene ACP1*A and comorbid features of Tourette syndrome." Neurosci Lett. 330(2):198-200. PMID:12231445
  43. [ + ] Kikawa KD, et al. (2002) "Regulation of the EphA2 kinase by the low molecular weight tyrosine phosphatase induces transformation." J Biol Chem. 277(42):39274-39279. PMID:12167657
  44. [ + ] Bottini N, et al. (2002) "ACP1 is associated with allergy." Allergy. 57(7):651-652. PMID:12100313
  45. [ + ] Bottini N, et al. (2002) "Activation of ZAP-70 through specific dephosphorylation at the inhibitory Tyr-292 by the low molecular weight phosphotyrosine phosphatase (LMPTP)." J Biol Chem. 277(27):24220-24224. PMID:11976341
  46. [ + ] Nicolas G, et al. (2002) "Tyrosine phosphorylation regulates alpha II spectrin cleavage by calpain." Mol Cell Biol. 22(10):3527-3536. PMID:11971983
  47. [ + ] Tarskaia LA, et al. (2002) "[Genetic polymorphism of erythrocytic enzymes in Yakut populations]" Genetika. 38(3):426-429. PMID:11963573
  48. [ + ] Spitsyn VA, et al. (2001) "[Genetic predisposition to development of toxic liver cirrhosis caused by alcohol]" Genetika. 37(5):698-707. PMID:11436564
  49. [ + ] Sergeev AS, et al. (2001) "[Analysis of heterozygosity levels at P1,TF, PGM1, ACP1, HP, GC, GLO, C3, and ESD loci in pulmonary tuberculosis patients with different treatment outcomes]" Genetika. 37(12):1673-1680. PMID:11785295
  50. [ + ] Bottini E, et al. (2001) "The genetics of signal transduction and the effect of smoking on intrauterine growth." Int J Epidemiol. 30(2):400-402. PMID:11369750