AADAC | GeneID:519557 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 519557 Official Symbol AADAC
Locus N/A Gene Type protein-coding
Synonyms MGC142384
Full Name N/A
Description arylacetamide deacetylase (esterase)
Chromosome N/A
Also Known As arylacetamide deacetylase
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 37436

ID Symbol Protein Species
GeneID:13 AADAC NP_001077.2 Homo sapiens
GeneID:57300 Aadac NP_065413.1 Rattus norvegicus
GeneID:67758 Aadac NP_075872.1 Mus musculus
GeneID:425034 AADACL2 XP_422836.2 Gallus gallus
GeneID:460785 AADAC XP_001145851.1 Pan troglodytes
GeneID:477115 AADAC XP_534309.2 Canis lupus familiaris
GeneID:519557 AADAC NP_001069259.1 Bos taurus
GeneID:100148912 LOC100148912 XP_001923714.1 Danio rerio

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005783 Component endoplasmic reticulum
GO:0005789 Component endoplasmic reticulum membrane
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0005792 Component microsome
GO:0004091 Function carboxylesterase activity
GO:0016787 Function hydrolase activity
GO:0008152 Process metabolic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001075791 NP_001069259

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000015373 MI0005035 bta-miR-192 CUGACCUAUGAAUUGACAGCCAG
ENSBTAT00000015373 MI0005045 bta-miR-361 UUAUCAGAAUCUCCAGGGGUAC
ENSBTAT00000015373 MI0000437 hsa-miR-1 UGGAAUGUAAAGAAGUAUGUAU
ENSBTAT00000015373 MI0000651 hsa-miR-1 UGGAAUGUAAAGAAGUAUGUAU
ENSBTAT00000015373 MI0000463 hsa-miR-153 UUGCAUAGUCACAAAAGUGAUC
ENSBTAT00000015373 MI0000464 hsa-miR-153 UUGCAUAGUCACAAAAGUGAUC
ENSBTAT00000015373 MI0000272 hsa-miR-182 UUUGGCAAUGGUAGAACUCACACU
ENSBTAT00000015373 MI0000490 hsa-miR-206 UGGAAUGUAAGGAAGUGUGUGG
ENSBTAT00000015373 MI0000296 hsa-miR-219-5p UGAUUGUCCAAACGCAAUUCU
ENSBTAT00000015373 MI0000740 hsa-miR-219-5p UGAUUGUCCAAACGCAAUUCU
ENSBTAT00000015373 MI0000814 hsa-miR-338-3p UCCAGCAUCAGUGAUUUUGUUG
ENSBTAT00000015373 MI0000776 hsa-miR-376c AACAUAGAGGAAAUUCCACGU
ENSBTAT00000015373 MI0001735 hsa-miR-409-3p GAAUGUUGCUCGGUGAACCCCU
ENSBTAT00000015373 MI0003612 hsa-miR-548a-5p AAAAGUAAUUGCGAGUUUUACC
ENSBTAT00000015373 MI0003596 hsa-miR-548b-5p AAAAGUAAUUGUGGUUUUGGCC
ENSBTAT00000015373 MI0003630 hsa-miR-548c-5p AAAAGUAAUUGCGGUUUUUGCC
ENSBTAT00000015373 MI0003668 hsa-miR-548d-5p AAAAGUAAUUGUGGUUUUUGCC
ENSBTAT00000015373 MI0003671 hsa-miR-548d-5p AAAAGUAAUUGUGGUUUUUGCC
ENSBTAT00000015373 MI0003578 hsa-miR-571 UGAGUUGGCCAUCUGAGUGAG
ENSBTAT00000015373 MI0003906 hsa-miR-802 CAGUAACAAAGAUUCAUCCUUGU
ENSBTAT00000015373 MI0002400 mmu-miR-465a-5p UAUUUAGAAUGGCACUGAUGUGA
ENSBTAT00000015373 MI0005498 mmu-miR-465b-5p UAUUUAGAAUGGUGCUGAUCUG
ENSBTAT00000015373 MI0005499 mmu-miR-465b-5p UAUUUAGAAUGGUGCUGAUCUG
ENSBTAT00000015373 MI0005500 mmu-miR-465c-5p UAUUUAGAAUGGCGCUGAUCUG
ENSBTAT00000015373 MI0005501 mmu-miR-465c-5p UAUUUAGAAUGGCGCUGAUCUG
ENSBTAT00000015373 MI0002401 mmu-miR-466a-3p UAUACAUACACGCACACAUAAGA
ENSBTAT00000015373 MI0005504 mmu-miR-466b-3-3p AAUACAUACACGCACACAUAAGA
ENSBTAT00000015373 MI0005546 mmu-miR-466d-3p UAUACAUACACGCACACAUAG
ENSBTAT00000015373 MI0005206 mmu-miR-742 GAAAGCCACCAUGCUGGGUAAA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene