A1BG | GeneID:518955 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 518955 Official Symbol A1BG
Locus N/A Gene Type protein-coding
Synonyms MGC127797
Full Name N/A
Description alpha-1-B glycoprotein
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 11167

ID Symbol Protein Species
GeneID:1 A1BG NP_570602.2 Homo sapiens
GeneID:117586 A1bg NP_001074536.1 Mus musculus
GeneID:140656 A1bg NP_071594.2 Rattus norvegicus
GeneID:484230 A1BG XP_541346.2 Canis lupus familiaris
GeneID:518955 A1BG NP_001039708.1 Bos taurus
GeneID:742390 A1BG XP_001146598.1 Pan troglodytes

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005576 Component extracellular region

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001046243 NP_001039708

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000012837 MI0004756 bta-miR-145 GUCCAGUUUUCCCAGGAAUCCCU
ENSBTAT00000012837 MI0005031 bta-miR-17-3p ACUGCAGUGAAGGCACUUGU
ENSBTAT00000012837 MI0001640 cfa-miR-448 UUGCAUAUGUAGGAUGUCCCAU
ENSBTAT00000012837 MI0004997 gga-miR-456 CAGGCUGGUUAGAUGGUUGUCA
ENSBTAT00000012837 MI0000090 hsa-miR-32 UAUUGCACAUUACUAAGUUGCA
ENSBTAT00000012837 MI0003194 hsa-miR-507 UUUUGCACCUUUUGGAGUGAA
ENSBTAT00000012837 MI0003180 hsa-miR-516a-5p UUCUCGAGGAAAGAAGCACUUUC
ENSBTAT00000012837 MI0003181 hsa-miR-516a-5p UUCUCGAGGAAAGAAGCACUUUC
ENSBTAT00000012837 MI0003686 hsa-miR-542-5p UCGGGGAUCAUCAUGUCACGAGA
ENSBTAT00000012837 MI0003515 hsa-miR-544 AUUCUGCAUUUUUAGCAAGUUC
ENSBTAT00000012837 MI0003578 hsa-miR-571 UGAGUUGGCCAUCUGAGUGAG
ENSBTAT00000012837 MI0003631 hsa-miR-617 AGACUUCCCAUUUGAAGGUGGC
ENSBTAT00000012837 MI0003632 hsa-miR-618 AAACUCUACUUGUCCUUCUGAGU
ENSBTAT00000012837 MI0003638 hsa-miR-624 CACAAGGUAUUGGUAUUACCU
ENSBTAT00000012837 MI0003640 hsa-miR-626 AGCUGUCUGAAAAUGUCUU
ENSBTAT00000012837 MI0003653 hsa-miR-638 AGGGAUCGCGGGCGGGUGGCGGCCU
ENSBTAT00000012837 MI0003654 hsa-miR-639 AUCGCUGCGGUUGCGAGCGCUGU
ENSBTAT00000012837 MI0003836 hsa-miR-766 ACUCCAGCCCCACAGCCUCAGC
ENSBTAT00000012837 MI0005118 hsa-miR-770-5p UCCAGUACCACGUGUCAGGGCCA
ENSBTAT00000012837 MI0002400 mmu-miR-465a-3p GAUCAGGGCCUUUCUAAGUAGA
ENSBTAT00000012837 MI0004553 mmu-miR-666-3p GGCUGCAGCGUGAUCGCCUGCU
ENSBTAT00000012837 MI0004662 mmu-miR-693-3p GCAGCUUUCAGAUGUGGCUGUAA
ENSBTAT00000012837 MI0004675 mmu-miR-695 AGAUUGGGCAUAGGUGACUGAA
ENSBTAT00000012837 MI0004693 mmu-miR-709 GGAGGCAGAGGCAGGAGGA
ENSBTAT00000012837 MI0004678 mmu-miR-720 AUCUCGCUGGGGCCUCCA
ENSBTAT00000012837 MI0005477 mmu-miR-883b-3p UAACUGCAACAUCUCUCAGUAU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene