ACCN5 | GeneID:51802 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 51802 Official Symbol ACCN5
Locus N/A Gene Type protein-coding
Synonyms HINAC; INAC
Full Name amiloride-sensitive cation channel 5, intestinal
Description amiloride-sensitive cation channel 5, intestinal
Chromosome 4q31.3-q32
Also Known As amiloride-sensitive sodium channel
Summary This gene belongs to the amiloride-sensitive Na+ channel and degenerin (NaC/DEG) family, members of which have been identified in many animal species ranging from the nematode to human. The amiloride-sensitive Na(+) channel encoded by this gene is primarily expressed in the small intestine, however, its exact function is not known. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 41171

ID Symbol Protein Species
GeneID:51802 ACCN5 NP_059115.1 Homo sapiens
GeneID:58170 Accn5 NP_067345.1 Mus musculus
GeneID:63866 Accn5 NP_071563.1 Rattus norvegicus
GeneID:428723 ACCN5 XP_426281.2 Gallus gallus
GeneID:482664 ACCN5 XP_539781.1 Canis lupus familiaris
GeneID:736182 ACCN5 XP_001139934.1 Pan troglodytes

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab48728 ACCN5 antibody (ab48728); Rabbit polyclonal to ACCN5
2 scbt ACCN5 ACCN5 Antibody / ACCN5 Antibodies;
3 sigma HPA014903 Anti-ACCN5 antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of ACCN5 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ACCN5 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0005886 Component plasma membrane
GO:0005216 Function ion channel activity
GO:0005272 Function sodium channel activity
GO:0031402 Function sodium ion binding
GO:0006811 Process ion transport
GO:0006814 Process sodium ion transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_017419  UCSC Browser NP_059115

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000264432 MI0000452 hsa-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
ENST00000264432 MI0000453 hsa-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
ENST00000264432 MI0000810 hsa-miR-135b UAUGGCUUUUCAUUCCUAUGUGA
ENST00000264432 MI0000457 hsa-miR-141 UAACACUGUCUGGUAAAGAUGG
ENST00000264432 MI0000273 hsa-miR-183* GUGAAUUACCGAAGGGCCAUAA
ENST00000264432 MI0003130 hsa-miR-202 AGAGGUAUAGGGCAUGGGAA
ENST00000264432 MI0000298 hsa-miR-221 AGCUACAUUGUCUGCUGGGUUUC
ENST00000264432 MI0000781 hsa-miR-373* ACUCAAAAUGGGGGCGCUUUCC
ENST00000264432 MI0001637 hsa-miR-448 UUGCAUAUGUAGGAUGUCCCAU
ENST00000264432 MI0003167 hsa-miR-516b AUCUGGAGGUAAGAAGCACUUU
ENST00000264432 MI0003172 hsa-miR-516b AUCUGGAGGUAAGAAGCACUUU
ENST00000264432 MI0003629 hsa-miR-616* ACUCAAAACCCUUCAGUGACUU
ENST00000264432 MI0003639 hsa-miR-625* GACUAUAGAACUUUCCCCCUCA
ENST00000264432 MI0005769 hsa-miR-944 AAAUUAUUGUACAUCGGAUGAG
ENST00000264432 MI0005205 mmu-miR-741 UGAGAGAUGCCAUUCUAUGUAGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Acetaminophen
  • Acetaminophen affects the expression of ACCN5 mRNA
17562736
pirinixic acid
  • pirinixic acid results in increased expression of ACCN5 mRNA
18301758

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Edema inferred via pirinixic acid 12083418
Liver Neoplasms inferred via pirinixic acid 15890375
Hepatitis, Toxic inferred via Acetaminophen 2444490, 17522070, 14986274, 16227642, 15968718, 16177239, 17562736, 16081117
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Schaefer L, et al. (2000) "Molecular cloning, functional expression and chromosomal localization of an amiloride-sensitive Na(+) channel from human small intestine." FEBS Lett. 471(2-3):205-210. PMID:10767424