ACSL5 | GeneID:51703 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 51703 Official Symbol ACSL5
Locus RP11-324O2.5 Gene Type protein-coding
Synonyms ACS2; ACS5; FACL5
Full Name acyl-CoA synthetase long-chain family member 5
Description acyl-CoA synthetase long-chain family member 5
Chromosome 10q25.1-q25.2
Also Known As FACL5 for fatty acid coenzyme A ligase 5; OTTHUMP00000020489; OTTHUMP00000020490; fatty acid coenzyme A ligase 5; fatty-acid-Coenzyme A ligase, long-chain 5; long-chain acyl-CoA synthetase 5; long-chain fatty acid coenzyme A ligase 5
Summary The protein encoded by this gene is an isozyme of the long-chain fatty-acid-coenzyme A ligase family. Although differing in substrate specificity, subcellular localization, and tissue distribution, all isozymes of this family convert free long-chain fatty acids into fatty acyl-CoA esters, and thereby play a key role in lipid biosynthesis and fatty acid degradation. This isozyme is highly expressed in uterus and spleen, and in trace amounts in normal brain, but has markedly increased levels in malignant gliomas. This gene functions in mediating fatty acid-induced glioma cell growth. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 69208

ID Symbol Protein Species
GeneID:51703 ACSL5 NP_057318.2 Homo sapiens
GeneID:94340 Acsl5 NP_446059.1 Rattus norvegicus
GeneID:171643 Y65B4BL.5 NP_490744.1 Caenorhabditis elegans
GeneID:423896 RCJMB04_26g6 NP_001026408.1 Gallus gallus
GeneID:433256 Acsl5 NP_082252.1 Mus musculus
GeneID:447860 zgc:92083 NP_001004599.1 Danio rerio
GeneID:450739 ACSL5 XP_001146649.1 Pan troglodytes
GeneID:477820 ACSL5 XP_535014.2 Canis lupus familiaris
GeneID:514159 ACSL5 NP_001069118.1 Bos taurus
GeneID:832820 LACS7 NP_198112.2 Arabidopsis thaliana

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab48035 ACSL5 antibody (ab48035); Goat polyclonal to ACSL5
2 abcam ab57210 ACSL5 antibody (ab57210); Mouse monoclonal to ACSL5
3 abgent AP2536a FACL5 Antibody (N-term); Purified Rabbit Polyclonal Antibody (Pab)
4 abnova H00051703-M01 ACSL5 monoclonal antibody (M01), clone 5H8; Mouse monoclonal antibody raised against a partial recombinant ACSL5.
5 acris AP16489PU-N ACSL5; antibody Ab
6 acris AP08976PU-N ACSL5 (C-term); antibody Ab
7 acris AP12262PU-N ACSL5 (N-term); antibody Ab
8 scbt ACSL5 ACSL5 Antibody / ACSL5 Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of ACSL5 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ACSL5 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005783 Component endoplasmic reticulum
GO:0005789 Component endoplasmic reticulum membrane
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0005792 Component microsome
GO:0005741 Component mitochondrial outer membrane
GO:0005739 Component mitochondrion
GO:0005778 Component peroxisomal membrane
GO:0005777 Component peroxisome
GO:0005524 Function ATP binding
GO:0016874 Function ligase activity
GO:0004467 Function long-chain-fatty-acid-CoA ligase activity
GO:0000287 Function magnesium ion binding
GO:0000166 Function nucleotide binding
GO:0006631 Process fatty acid metabolic process
GO:0006629 Process lipid metabolic process
GO:0008152 Process metabolic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_016234  UCSC Browser NP_057318
2 NM_203379  UCSC Browser NP_976313
3 NM_203380  UCSC Browser NP_976314

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000354273 MI0000294 hsa-miR-218-1* AUGGUUCCGUCAAGCACCAUGG
ENST00000354273 MI0003673 hsa-miR-449b AGGCAGUGUAUUGUUAGCUGGC
ENST00000354273 MI0003138 hsa-miR-497 CAGCAGCACACUGUGGUUUGU
ENST00000354273 MI0004523 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENST00000354273 MI0004667 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENST00000354273 MI0004668 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENST00000354273 MI0000636 rno-miR-349 CAGCCCUGCUGUCUUAACCUCU
ENST00000354655 MI0000294 hsa-miR-218-1* AUGGUUCCGUCAAGCACCAUGG
ENST00000354655 MI0003673 hsa-miR-449b AGGCAGUGUAUUGUUAGCUGGC
ENST00000354655 MI0003138 hsa-miR-497 CAGCAGCACACUGUGGUUUGU
ENST00000354655 MI0004523 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENST00000354655 MI0004667 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENST00000354655 MI0004668 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENST00000354655 MI0000636 rno-miR-349 CAGCCCUGCUGUCUUAACCUCU
ENST00000356116 MI0000108 hsa-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENST00000356116 MI0000109 hsa-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENST00000356116 MI0000438 hsa-miR-15b UAGCAGCACAUCAUGGUUUACA
ENST00000356116 MI0000294 hsa-miR-218-1* AUGGUUCCGUCAAGCACCAUGG
ENST00000356116 MI0003673 hsa-miR-449b AGGCAGUGUAUUGUUAGCUGGC
ENST00000356116 MI0003138 hsa-miR-497 CAGCAGCACACUGUGGUUUGU
ENST00000356116 MI0003630 hsa-miR-548c-3p CAAAAAUCUCAAUUACUUUUGC
ENST00000356116 MI0003648 hsa-miR-633 CUAAUAGUAUCUACCACAAUAAA
ENST00000356116 MI0003834 hsa-miR-769-3p CUGGGAUCUCCGGGGUCUUGGUU
ENST00000356116 MI0005560 hsa-miR-885-3p AGGCAGCGGGGUGUAGUGGAUA
ENST00000356116 MI0005758 hsa-miR-936 ACAGUAGAGGGAGGAAUCGCAG
ENST00000356116 MI0004523 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENST00000356116 MI0004667 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENST00000356116 MI0004668 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENST00000356116 MI0004662 mmu-miR-693-3p GCAGCUUUCAGAUGUGGCUGUAA
ENST00000356116 MI0000636 rno-miR-349 CAGCCCUGCUGUCUUAACCUCU
ENST00000356116 MI0003722 rno-miR-664 UAUUCAUUUACUCCCCAGCCUA
ENST00000356116 MI0003723 rno-miR-664 UAUUCAUUUACUCCCCAGCCUA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Carbon Tetrachloride
  • Carbon Tetrachloride results in increased expression of ACSL5 mRNA
17484886
Dietary Fats
  • Dietary Fats results in decreased expression of ACSL5 mRNA
18042831
Diethylstilbestrol
  • Diethylstilbestrol results in increased expression of ACSL5 mRNA
17005392
Ethinyl Estradiol
  • Ethinyl Estradiol results in increased expression of ACSL5 mRNA
16174780
Ethinyl Estradiol
  • Ethinyl Estradiol results in decreased expression of ACSL5 mRNA
17108234
Lindane
  • Lindane results in decreased expression of ACSL5 mRNA
17785943
nitrosobenzylmethylamine
  • nitrosobenzylmethylamine results in increased expression of ACSL5 mRNA
17616710
palm oil
  • palm oil results in decreased expression of ACSL5 mRNA
18042831
perfluorooctanoic acid
  • perfluorooctanoic acid results in increased expression of ACSL5 mRNA
17681415
pirinixic acid
  • pirinixic acid results in increased expression of ACSL5 mRNA
18301758, 15375163
Triiodothyronine
  • Triiodothyronine results in increased expression of ACSL5 mRNA
15953391
Tunicamycin
  • Tunicamycin results in increased expression of ACSL5 mRNA
17127020

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Edema inferred via pirinixic acid 12083418
Liver Neoplasms inferred via pirinixic acid 15890375
Edema inferred via perfluorooctanoic acid 17259670, 12083418
Hepatomegaly inferred via perfluorooctanoic acid 3609246
Hyperalgesia inferred via perfluorooctanoic acid 12083418
Inflammation inferred via perfluorooctanoic acid 12083418
Leydig Cell Tumor inferred via perfluorooctanoic acid 8812269
Liver Neoplasms inferred via perfluorooctanoic acid 14757943
Niemann-Pick Disease, Type C inferred via perfluorooctanoic acid 9802331
Prenatal Exposure Delayed Effects inferred via perfluorooctanoic acid 17132714
Esophageal Neoplasms inferred via nitrosobenzylmethylamine 16805852, 16510608, 16704527, 15547721, 15623463, 15150132, 15264214, 15878914, 15547733
Stomach Neoplasms inferred via nitrosobenzylmethylamine 17575124, 12958204
Agricultural Workers' Diseases inferred via Lindane 12661182
Breast Neoplasms inferred via Lindane 14688026
Neoplasms inferred via Lindane 16818664, 12807735
Prostatic Neoplasms inferred via Lindane 14688026, 12661182
Seizures inferred via Lindane 7539098
Acne Vulgaris inferred via Ethinyl Estradiol 17505938
Adenocarcinoma inferred via Ethinyl Estradiol 14692618
Arteriosclerosis inferred via Ethinyl Estradiol 11256880
Arthritis, Experimental inferred via Ethinyl Estradiol 15885639
Cholestasis inferred via Ethinyl Estradiol 17110522, 16105132, 11677210, 15861022, 17333356, 17681005, 16919318
Encephalomyelitis, Autoimmune, Experimental inferred via Ethinyl Estradiol 12538720
Fatty Liver inferred via Ethinyl Estradiol 15345470
Hypospadias inferred via Ethinyl Estradiol 16569931, 16945680
Infertility, Female inferred via Ethinyl Estradiol 12013081
Infertility, Male inferred via Ethinyl Estradiol 17937319
Panic Disorder inferred via Ethinyl Estradiol 11578682
Pruritus inferred via Ethinyl Estradiol 16919318, 15861022
Spermatocele inferred via Ethinyl Estradiol 16709447
Thrombophilia inferred via Ethinyl Estradiol 11994571
Thrombosis inferred via Ethinyl Estradiol 15669648
Uterine Neoplasms inferred via Ethinyl Estradiol 14692618
Venous Thrombosis inferred via Ethinyl Estradiol 15869587
Amyloidosis inferred via Diethylstilbestrol 15469931
Breast Neoplasms inferred via Diethylstilbestrol 15324884, 17129689
Carcinoma, Hepatocellular inferred via Diethylstilbestrol 16924424, 15948411
Cryptorchidism inferred via Diethylstilbestrol 12952375, 16002989
Endometrial Hyperplasia inferred via Diethylstilbestrol 16402032
Endometrial Neoplasms inferred via Diethylstilbestrol 15700306, 16804899
Female Urogenital Diseases inferred via Diethylstilbestrol 16513791, 16534752, 15751030, 16611131, 16002989
Genital Neoplasms, Female inferred via Diethylstilbestrol 16452187
Hyperplasia inferred via Diethylstilbestrol 12960047, 14722030
Hypospadias inferred via Diethylstilbestrol 16002989
Infertility inferred via Diethylstilbestrol 15036965
Kidney Neoplasms inferred via Diethylstilbestrol 15003126, 16762066, 14681315
Liver Neoplasms inferred via Diethylstilbestrol 16712894, 15890375
Lupus Nephritis inferred via Diethylstilbestrol 15166399
Lymphoma inferred via Diethylstilbestrol 15700306
Male Urogenital Diseases inferred via Diethylstilbestrol 16002989
Neoplasms inferred via Diethylstilbestrol 15313581
Pituitary Diseases inferred via Diethylstilbestrol 14722030
Pituitary Neoplasms inferred via Diethylstilbestrol 15687265, 16977796
Prostatic Neoplasms inferred via Diethylstilbestrol 15846301, 17136230, 15046698
Spermatocele inferred via Diethylstilbestrol 16709447, 16002989
Urinary Bladder Neoplasms inferred via Diethylstilbestrol 16712894, 16452187
Uterine Cervical Neoplasms inferred via Diethylstilbestrol 16175088
Uterine Diseases inferred via Diethylstilbestrol 14652134
Uterine Neoplasms inferred via Diethylstilbestrol 15809267, 16690809
Vaginal Neoplasms inferred via Diethylstilbestrol 16513791, 16002989
Arteriosclerosis inferred via Dietary Fats 15238619
Dyslipidemias inferred via Dietary Fats 18367378
Insulin Resistance inferred via Dietary Fats 18457598
Obesity inferred via Dietary Fats 18457598, 17217161
Carbon Tetrachloride Poisoning inferred via Carbon Tetrachloride 16192424, 16011737, 15700767, 16124888, 16227642, 10355542, 16097048, 15673190, 16050911
Fatty Liver inferred via Carbon Tetrachloride 16045604, 16239168, 15959796, 12795759, 61145, 12631006, 17595544
Hepatitis, Toxic inferred via Carbon Tetrachloride 17522070, 15027814, 11566570, 15998439, 16227642, 15968718, 16177239
Hyperbilirubinemia inferred via Carbon Tetrachloride 16899240
Liver Cirrhosis inferred via Carbon Tetrachloride 17174718, 17334410, 16943688, 16221502, 16239168
Liver Cirrhosis, Experimental inferred via Carbon Tetrachloride 16192424, 16248980, 17805973, 17976157, 18395095, 12666154, 18277467, 18205269, 14716496, 15730626, 12632514, 15052691, 12632512, 17766677, 18418968, 18376398, 12389079, 18187930, 18210741, 16015684, 12741479, 14724832, 18472094, 15931870, 17698563, 15893842, 12958196, 17640975, 18412020, 17714472, 14512876, 12609069, 18166357, 17922224, 18420326, 15876570, 12445421, 12445418, 15959796, 12898905, 18317297, 17761835, 14620537, 18472332, 14716833, 16136751, 17481882, 17900296, 15123356, 18339082, 18429990, 12546737, 18006644, 18481824, 15057751, 12586293, 18054572, 10355542, 16011737, 18251166, 17823541, 17944888, 18395914, 18279442, 16027843, 15996030, 16033810, 17565644, 17869086, 17708605, 12667390, 14748882, 13678700, 15818738, 17631135, 16097048, 15673190, 12649538, 17721639, 16638106, 18156304, 17557913, 17525996, 15925388, 16116963
Liver Diseases inferred via Carbon Tetrachloride 16246199, 15720792, 15830285, 17285989, 16964402
Liver Failure inferred via Carbon Tetrachloride 15123358
Liver Failure, Acute inferred via Carbon Tetrachloride 14706259, 16899240
Liver Neoplasms, Experimental inferred via Carbon Tetrachloride 15583823

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Mashima T, et al. (2009) "Promotion of glioma cell survival by acyl-CoA synthetase 5 under extracellular acidosis conditions." Oncogene. 28(1):9-19. PMID:18806831
  2. [ + ] Gaisa NT, et al. (2008) "Expression of acyl-CoA synthetase 5 in human epidermis." Histol Histopathol. 23(4):451-458. PMID:18228202
  3. [ + ] Adamo KB, et al. (2007) "Peroxisome proliferator-activated receptor gamma 2 and acyl-CoA synthetase 5 polymorphisms influence diet response." Obesity (Silver Spring). 15(5):1068-1075. PMID:17495181
  4. [ + ] Zhou Y, et al. (2007) "Transcriptional activation of hepatic ACSL3 and ACSL5 by oncostatin m reduces hypertriglyceridemia through enhanced beta-oxidation." Arterioscler Thromb Vasc Biol. 27(10):2198-2205. PMID:17761945
  5. [ + ] Gassler N, et al. (2007) "Regulation of enterocyte apoptosis by acyl-CoA synthetase 5 splicing." Gastroenterology. 133(2):587-598. PMID:17681178
  6. [ + ] Obermuller N, et al. (2006) "Coeliac disease is associated with impaired expression of acyl-CoA-synthetase 5." Int J Colorectal Dis. 21(2):130-134. PMID:15809837
  7. [ + ] Achouri Y, et al. (2005) "Long chain fatty acyl-CoA synthetase 5 expression is induced by insulin and glucose: involvement of sterol regulatory element-binding protein-1c." Biochimie. 87(12):1149-1155. PMID:16198472
  8. [ + ] Gassler N, et al. (2005) "Characterization of metaplastic and heterotopic epithelia in the human gastrointestinal tract by the expression pattern of acyl-CoA synthetase 5." Histol Histopathol. 20(2):409-414. PMID:15736044
  9. [ + ] Mashek DG, et al. (2004) "Revised nomenclature for the mammalian long-chain acyl-CoA synthetase gene family." J Lipid Res. 45(10):1958-1961. PMID:15292367
  10. [ + ] Deloukas P, et al. (2004) "The DNA sequence and comparative analysis of human chromosome 10." Nature. 429(6990):375-381. PMID:15164054
  11. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  12. [ + ] Clark HF, et al. (2003) "The secreted protein discovery initiative (SPDI), a large-scale effort to identify novel human secreted and transmembrane proteins: a bioinformatics assessment." Genome Res. 13(10):2265-2270. PMID:12975309
  13. [ + ] Gassler N, et al. (2003) "Impaired expression of acyl-CoA-synthetase 5 in epithelial tumors of the small intestine." Hum Pathol. 34(10):1048-1052. PMID:14608540
  14. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  15. [ + ] Lewin TM, et al. (2002) "Rat liver acyl-CoA synthetase 4 is a peripheral-membrane protein located in two distinct subcellular organelles, peroxisomes, and mitochondrial-associated membrane." Arch Biochem Biophys. 404(2):263-270. PMID:12147264
  16. [ + ] Lewin TM, et al. (2001) "Acyl-CoA synthetase isoforms 1, 4, and 5 are present in different subcellular membranes in rat liver and can be inhibited independently." J Biol Chem. 276(27):24674-24679. PMID:11319232
  17. [ + ] Minekura H, et al. (2001) "Genomic organization and transcription units of the human acyl-CoA synthetase 3 gene." Gene. 278(1-2):185-192. PMID:11707336
  18. [ + ] Yamashita Y, et al. (2000) "Fatty acid induced glioma cell growth is mediated by the acyl-CoA synthetase 5 gene located on chromosome 10q25.1-q25.2, a region frequently deleted in malignant gliomas." Oncogene. 19(51):5919-5925. PMID:11127823
  19. [ + ] Suzuki Y, et al. (1997) "Construction and characterization of a full length-enriched and a 5'-end-enriched cDNA library." Gene. 200(1-2):149-156. PMID:9373149
  20. [ + ] Maruyama K, et al. (1994) "Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides." Gene. 138(1-2):171-174. PMID:8125298