ENPP2 | GeneID:5168 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 5168 Official Symbol ENPP2
Locus N/A Gene Type protein-coding
Synonyms ATX; ATX-X; AUTOTAXIN; FLJ26803; LysoPLD; NPP2; PD-IALPHA; PDNP2
Full Name ectonucleotide pyrophosphatase/phosphodiesterase 2
Description ectonucleotide pyrophosphatase/phosphodiesterase 2
Chromosome 8q24.1
Also Known As autotaxin; autotaxin-t; phosphodiesterase I/nucleotide pyrophosphatase 2; plasma lysophospholipase D
Summary The protein encoded by this gene functions as both a phosphodiesterase, which cleaves phosphodiester bonds at the 5' end of oligonucleotides, and a phospholipase, which catalyzes production of lysophosphatidic acid (LPA) in extracellular fluids. LPA evokes growth factor-like responses including stimulation of cell proliferation and chemotaxis. This gene product stimulates the motility of tumor cells and has angiogenic properties, and its expression is upregulated in several kinds of carcinomas. The gene product is secreted and further processed to make the biologically active form. Several alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 4526

ID Symbol Protein Species
GeneID:5168 ENPP2 NP_006200.3 Homo sapiens
GeneID:18606 Enpp2 NP_056559.1 Mus musculus
GeneID:84050 Enpp2 NP_476445.2 Rattus norvegicus
GeneID:393575 enpp2 NP_956897.1 Danio rerio
GeneID:420361 ENPP2 XP_418466.2 Gallus gallus
GeneID:464353 ENPP2 XP_001143143.1 Pan troglodytes
GeneID:482026 ENPP2 XP_539147.2 Canis lupus familiaris
GeneID:532663 ENPP2 XP_611807.3 Bos taurus

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abgent AP2854c ENPP2 Antibody (Center K416); Purified Rabbit Polyclonal Antibody (Pab)
2 acris AP18009PU-N Autotaxin / ENPP2 Center; antibody Ab
3 acris AP05178PU-N Autotaxin / ENPP2; antibody
4 acris AP12517PU-N Autotaxin / ENPP2 (Center); antibody Ab
5 scbt ENPP2 ENPP2 Antibody / ENPP2 Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of ENPP2 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ENPP2 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005576 Component extracellular region
GO:0005887 Component integral to plasma membrane
GO:0005886 Component plasma membrane
GO:0047391 Function alkylglycerophosphoethanolamine phosphodiesterase activity
GO:0016787 Function hydrolase activity
GO:0046872 Function metal ion binding
GO:0003676 Function nucleic acid binding
GO:0004551 Function nucleotide diphosphatase activity
GO:0004528 Function phosphodiesterase I activity
GO:0008134 Function transcription factor binding
GO:0006928 Process cell motion
GO:0006935 Process chemotaxis
GO:0007186 Process G-protein coupled receptor protein signaling pathway
GO:0016042 Process lipid catabolic process
GO:0008152 Process metabolic process
GO:0006796 Process phosphate metabolic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001040092  UCSC Browser NP_001035181
2 NM_001130863  UCSC Browser NP_001124335
3 NM_006209  UCSC Browser NP_006200

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000075322 MI0000060 hsa-let-7a* CUAUACAAUCUACUGUCUUUC
ENST00000075322 MI0000062 hsa-let-7a* CUAUACAAUCUACUGUCUUUC
ENST00000075322 MI0000063 hsa-let-7b* CUAUACAACCUACUGCCUUCCC
ENST00000075322 MI0000065 hsa-let-7d* CUAUACGACCUGCUGCCUUUCU
ENST00000075322 MI0000067 hsa-let-7f-1* CUAUACAAUCUAUUGCCUUCCC
ENST00000075322 MI0000068 hsa-let-7f-2* CUAUACAGUCUACUGUCUUUCC
ENST00000075322 MI0000103 hsa-miR-101 UACAGUACUGUGAUAACUGAA
ENST00000075322 MI0000739 hsa-miR-101 UACAGUACUGUGAUAACUGAA
ENST00000075322 MI0000114 hsa-miR-107 AGCAGCAUUGUACAGGGCUAUCA
ENST00000075322 MI0000448 hsa-miR-130a CAGUGCAAUGUUAAAAGGGCAU
ENST00000075322 MI0000748 hsa-miR-130b CAGUGCAAUGAUGAAAGGGCAU
ENST00000075322 MI0000460 hsa-miR-144 UACAGUAUAGAUGAUGUACU
ENST00000075322 MI0000253 hsa-miR-148a UCAGUGCACUACAGAACUUUGU
ENST00000075322 MI0000811 hsa-miR-148b UCAGUGCAUCACAGAACUUUGU
ENST00000075322 MI0000479 hsa-miR-150* CUGGUACAGGCCUGGGGGACAG
ENST00000075322 MI0000462 hsa-miR-152 UCAGUGCAUGACAGAACUUGG
ENST00000075322 MI0000069 hsa-miR-15a UAGCAGCACAUAAUGGUUUGUG
ENST00000075322 MI0000438 hsa-miR-15b UAGCAGCACAUCAUGGUUUACA
ENST00000075322 MI0000070 hsa-miR-16 UAGCAGCACGUAAAUAUUGGCG
ENST00000075322 MI0000115 hsa-miR-16 UAGCAGCACGUAAAUAUUGGCG
ENST00000075322 MI0000070 hsa-miR-16-1* CCAGUAUUAACUGUGCUGCUGA
ENST00000075322 MI0000486 hsa-miR-190 UGAUAUGUUUGAUAUAUUAGGU
ENST00000075322 MI0005545 hsa-miR-190b UGAUAUGUUUGAUAUUGGGUU
ENST00000075322 MI0000286 hsa-miR-210 CUGUGCGUGUGACAGCGGCUGA
ENST00000075322 MI0005536 hsa-miR-220c ACACAGGGCUGUUGUGAAGACU
ENST00000075322 MI0000087 hsa-miR-29a UAGCACCAUCUGAAAUCGGUUA
ENST00000075322 MI0000105 hsa-miR-29b UAGCACCAUUUGAAAUCAGUGUU
ENST00000075322 MI0000107 hsa-miR-29b UAGCACCAUUUGAAAUCAGUGUU
ENST00000075322 MI0000105 hsa-miR-29b-1* GCUGGUUUCAUAUGGUGGUUUAGA
ENST00000075322 MI0000107 hsa-miR-29b-2* CUGGUUUCACAUGGUGGCUUAG
ENST00000075322 MI0000735 hsa-miR-29c UAGCACCAUUUGAAAUCGGUUA
ENST00000075322 MI0000816 hsa-miR-335 UCAAGAGCAAUAACGAAAAAUGU
ENST00000075322 MI0000814 hsa-miR-338-5p AACAAUAUCCUGGUGCUGAGUG
ENST00000075322 MI0000091 hsa-miR-33a GUGCAUUGUAGUUGCAUUGCA
ENST00000075322 MI0000091 hsa-miR-33a* CAAUGUUUCCACAGUGCAUCAC
ENST00000075322 MI0003646 hsa-miR-33b GUGCAUUGCUGUUGCAUUGC
ENST00000075322 MI0001735 hsa-miR-409-5p AGGUUACCCGAGCAACUUUGCAU
ENST00000075322 MI0002470 hsa-miR-486-5p UCCUGUACUGAGCUGCCCCGAG
ENST00000075322 MI0003183 hsa-miR-499-5p UUAAGACUUGCAGUGAUGUUU
ENST00000075322 MI0005717 hsa-miR-509-3-5p UACUGCAGACGUGGCAAUCAUG
ENST00000075322 MI0003196 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENST00000075322 MI0005530 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENST00000075322 MI0005717 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENST00000075322 MI0003196 hsa-miR-509-5p UACUGCAGACAGUGGCAAUCA
ENST00000075322 MI0005530 hsa-miR-509-5p UACUGCAGACAGUGGCAAUCA
ENST00000075322 MI0003197 hsa-miR-510 UACUCAGGAGAGUGGCAAUCAC
ENST00000075322 MI0003575 hsa-miR-551b* GAAAUCAAGCGUGGGUGAGACC
ENST00000075322 MI0003576 hsa-miR-569 AGUUAAUGAAUCCUGGAAAGU
ENST00000075322 MI0003582 hsa-miR-575 GAGCCAGUUGGACAGGAGC
ENST00000075322 MI0003589 hsa-miR-582-3p UAACUGGUUGAACAACUGAACC
ENST00000075322 MI0003595 hsa-miR-587 UUUCCAUAGGUGAUGAGUCAC
ENST00000075322 MI0003599 hsa-miR-589* UCAGAACAAAUGCCGGUUCCCAGA
ENST00000075322 MI0003617 hsa-miR-604 AGGCUGCGGAAUUCAGGAC
ENST00000075322 MI0003620 hsa-miR-607 GUUCAAAUCCAGAUCUAUAAC
ENST00000075322 MI0003642 hsa-miR-628-5p AUGCUGACAUAUUUACUAGAGG
ENST00000075322 MI0003648 hsa-miR-633 CUAAUAGUAUCUACCACAAUAAA
ENST00000075322 MI0003763 hsa-miR-767-3p UCUGCUCAUACCCCAUGGUUUCU
ENST00000075322 MI0005534 hsa-miR-891b UGCAACUUACCUGAGUCAUUGA
ENST00000075322 MI0000393 mmu-miR-295 AAAGUGCUACUACUUUUGAGUCU
ENST00000075322 MI0002400 mmu-miR-465a-5p UAUUUAGAAUGGCACUGAUGUGA
ENST00000075322 MI0005500 mmu-miR-465c-5p UAUUUAGAAUGGCGCUGAUCUG
ENST00000075322 MI0005501 mmu-miR-465c-5p UAUUUAGAAUGGCGCUGAUCUG
ENST00000075322 MI0002401 mmu-miR-466a-5p UAUGUGUGUGUACAUGUACAUA
ENST00000075322 MI0005504 mmu-miR-466b-3-3p AAUACAUACACGCACACAUAAGA
ENST00000075322 MI0005502 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENST00000075322 MI0005503 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENST00000075322 MI0005504 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENST00000075322 MI0005505 mmu-miR-466c-5p GAUGUGUGUGUGCAUGUACAUA
ENST00000075322 MI0005506 mmu-miR-466e-5p GAUGUGUGUGUACAUGUACAUA
ENST00000075322 MI0003523 mmu-miR-547 CUUGGUACAUCUUUGAGUGAG
ENST00000075322 MI0004553 mmu-miR-666-3p GGCUGCAGCGUGAUCGCCUGCU
ENST00000075322 MI0005204 mmu-miR-805 GAAUUGAUCAGGACAUAGGG
ENST00000259486 MI0000060 hsa-let-7a* CUAUACAAUCUACUGUCUUUC
ENST00000259486 MI0000062 hsa-let-7a* CUAUACAAUCUACUGUCUUUC
ENST00000259486 MI0000063 hsa-let-7b* CUAUACAACCUACUGCCUUCCC
ENST00000259486 MI0000065 hsa-let-7d* CUAUACGACCUGCUGCCUUUCU
ENST00000259486 MI0000067 hsa-let-7f-1* CUAUACAAUCUAUUGCCUUCCC
ENST00000259486 MI0000068 hsa-let-7f-2* CUAUACAGUCUACUGUCUUUCC
ENST00000259486 MI0000103 hsa-miR-101 UACAGUACUGUGAUAACUGAA
ENST00000259486 MI0000739 hsa-miR-101 UACAGUACUGUGAUAACUGAA
ENST00000259486 MI0000108 hsa-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENST00000259486 MI0000109 hsa-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENST00000259486 MI0000114 hsa-miR-107 AGCAGCAUUGUACAGGGCUAUCA
ENST00000259486 MI0000448 hsa-miR-130a CAGUGCAAUGUUAAAAGGGCAU
ENST00000259486 MI0000748 hsa-miR-130b CAGUGCAAUGAUGAAAGGGCAU
ENST00000259486 MI0000458 hsa-miR-142-3p UGUAGUGUUUCCUACUUUAUGGA
ENST00000259486 MI0000460 hsa-miR-144 UACAGUAUAGAUGAUGUACU
ENST00000259486 MI0000253 hsa-miR-148a UCAGUGCACUACAGAACUUUGU
ENST00000259486 MI0000811 hsa-miR-148b UCAGUGCAUCACAGAACUUUGU
ENST00000259486 MI0000479 hsa-miR-150* CUGGUACAGGCCUGGGGGACAG
ENST00000259486 MI0000462 hsa-miR-152 UCAGUGCAUGACAGAACUUGG
ENST00000259486 MI0000069 hsa-miR-15a UAGCAGCACAUAAUGGUUUGUG
ENST00000259486 MI0000438 hsa-miR-15b UAGCAGCACAUCAUGGUUUACA
ENST00000259486 MI0000070 hsa-miR-16 UAGCAGCACGUAAAUAUUGGCG
ENST00000259486 MI0000115 hsa-miR-16 UAGCAGCACGUAAAUAUUGGCG
ENST00000259486 MI0000070 hsa-miR-16-1* CCAGUAUUAACUGUGCUGCUGA
ENST00000259486 MI0000486 hsa-miR-190 UGAUAUGUUUGAUAUAUUAGGU
ENST00000259486 MI0005545 hsa-miR-190b UGAUAUGUUUGAUAUUGGGUU
ENST00000259486 MI0000488 hsa-miR-194 UGUAACAGCAACUCCAUGUGGA
ENST00000259486 MI0000732 hsa-miR-194 UGUAACAGCAACUCCAUGUGGA
ENST00000259486 MI0000489 hsa-miR-195 UAGCAGCACAGAAAUAUUGGC
ENST00000259486 MI0000073 hsa-miR-19a UGUGCAAAUCUAUGCAAAACUGA
ENST00000259486 MI0000074 hsa-miR-19b UGUGCAAAUCCAUGCAAAACUGA
ENST00000259486 MI0000075 hsa-miR-19b UGUGCAAAUCCAUGCAAAACUGA
ENST00000259486 MI0000286 hsa-miR-210 CUGUGCGUGUGACAGCGGCUGA
ENST00000259486 MI0005536 hsa-miR-220c ACACAGGGCUGUUGUGAAGACU
ENST00000259486 MI0000083 hsa-miR-26a UUCAAGUAAUCCAGGAUAGGCU
ENST00000259486 MI0000750 hsa-miR-26a UUCAAGUAAUCCAGGAUAGGCU
ENST00000259486 MI0000084 hsa-miR-26b UUCAAGUAAUUCAGGAUAGGU
ENST00000259486 MI0000085 hsa-miR-27a* AGGGCUUAGCUGCUUGUGAGCA
ENST00000259486 MI0000086 hsa-miR-28-3p CACUAGAUUGUGAGCUCCUGGA
ENST00000259486 MI0000087 hsa-miR-29a UAGCACCAUCUGAAAUCGGUUA
ENST00000259486 MI0000105 hsa-miR-29b UAGCACCAUUUGAAAUCAGUGUU
ENST00000259486 MI0000107 hsa-miR-29b UAGCACCAUUUGAAAUCAGUGUU
ENST00000259486 MI0000105 hsa-miR-29b-1* GCUGGUUUCAUAUGGUGGUUUAGA
ENST00000259486 MI0000107 hsa-miR-29b-2* CUGGUUUCACAUGGUGGCUUAG
ENST00000259486 MI0000735 hsa-miR-29c UAGCACCAUUUGAAAUCGGUUA
ENST00000259486 MI0005525 hsa-miR-300 UAUACAAGGGCAGACUCUCUCU
ENST00000259486 MI0000745 hsa-miR-301a CAGUGCAAUAGUAUUGUCAAAGC
ENST00000259486 MI0005568 hsa-miR-301b CAGUGCAAUGAUAUUGUCAAAGC
ENST00000259486 MI0000738 hsa-miR-302a UAAGUGCUUCCAUGUUUUGGUGA
ENST00000259486 MI0000774 hsa-miR-302d UAAGUGCUUCCAUGUUUGAGUGU
ENST00000259486 MI0000816 hsa-miR-335 UCAAGAGCAAUAACGAAAAAUGU
ENST00000259486 MI0000814 hsa-miR-338-5p AACAAUAUCCUGGUGCUGAGUG
ENST00000259486 MI0000091 hsa-miR-33a GUGCAUUGUAGUUGCAUUGCA
ENST00000259486 MI0000091 hsa-miR-33a* CAAUGUUUCCACAGUGCAUCAC
ENST00000259486 MI0003646 hsa-miR-33b GUGCAUUGCUGUUGCAUUGC
ENST00000259486 MI0000802 hsa-miR-340 UUAUAAAGCAAUGAGACUGAUU
ENST00000259486 MI0000760 hsa-miR-361-5p UUAUCAGAAUCUCCAGGGGUAC
ENST00000259486 MI0000789 hsa-miR-381 UAUACAAGGGCAAGCUCUCUGU
ENST00000259486 MI0001735 hsa-miR-409-5p AGGUUACCCGAGCAACUUUGCAU
ENST00000259486 MI0002470 hsa-miR-486-5p UCCUGUACUGAGCUGCCCCGAG
ENST00000259486 MI0003183 hsa-miR-499-5p UUAAGACUUGCAGUGAUGUUU
ENST00000259486 MI0005717 hsa-miR-509-3-5p UACUGCAGACGUGGCAAUCAUG
ENST00000259486 MI0003196 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENST00000259486 MI0005530 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENST00000259486 MI0005717 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENST00000259486 MI0003196 hsa-miR-509-5p UACUGCAGACAGUGGCAAUCA
ENST00000259486 MI0005530 hsa-miR-509-5p UACUGCAGACAGUGGCAAUCA
ENST00000259486 MI0003197 hsa-miR-510 UACUCAGGAGAGUGGCAAUCAC
ENST00000259486 MI0003575 hsa-miR-551b* GAAAUCAAGCGUGGGUGAGACC
ENST00000259486 MI0003558 hsa-miR-553 AAAACGGUGAGAUUUUGUUUU
ENST00000259486 MI0003564 hsa-miR-558 UGAGCUGCUGUACCAAAAU
ENST00000259486 MI0003576 hsa-miR-569 AGUUAAUGAAUCCUGGAAAGU
ENST00000259486 MI0003581 hsa-miR-574-5p UGAGUGUGUGUGUGUGAGUGUGU
ENST00000259486 MI0003582 hsa-miR-575 GAGCCAGUUGGACAGGAGC
ENST00000259486 MI0003589 hsa-miR-582-3p UAACUGGUUGAACAACUGAACC
ENST00000259486 MI0003595 hsa-miR-587 UUUCCAUAGGUGAUGAGUCAC
ENST00000259486 MI0003599 hsa-miR-589* UCAGAACAAAUGCCGGUUCCCAGA
ENST00000259486 MI0003617 hsa-miR-604 AGGCUGCGGAAUUCAGGAC
ENST00000259486 MI0003620 hsa-miR-607 GUUCAAAUCCAGAUCUAUAAC
ENST00000259486 MI0003638 hsa-miR-624 CACAAGGUAUUGGUAUUACCU
ENST00000259486 MI0003642 hsa-miR-628-5p AUGCUGACAUAUUUACUAGAGG
ENST00000259486 MI0003648 hsa-miR-633 CUAAUAGUAUCUACCACAAUAAA
ENST00000259486 MI0003763 hsa-miR-767-3p UCUGCUCAUACCCCAUGGUUUCU
ENST00000259486 MI0005534 hsa-miR-891b UGCAACUUACCUGAGUCAUUGA
ENST00000259486 MI0000392 mmu-miR-294 AAAGUGCUUCCCUUUUGUGUGU
ENST00000259486 MI0000393 mmu-miR-295 AAAGUGCUACUACUUUUGAGUCU
ENST00000259486 MI0001526 mmu-miR-434-5p GCUCGACUCAUGGUUUGAACCA
ENST00000259486 MI0002400 mmu-miR-465a-5p UAUUUAGAAUGGCACUGAUGUGA
ENST00000259486 MI0005498 mmu-miR-465b-5p UAUUUAGAAUGGUGCUGAUCUG
ENST00000259486 MI0005499 mmu-miR-465b-5p UAUUUAGAAUGGUGCUGAUCUG
ENST00000259486 MI0005500 mmu-miR-465c-5p UAUUUAGAAUGGCGCUGAUCUG
ENST00000259486 MI0005501 mmu-miR-465c-5p UAUUUAGAAUGGCGCUGAUCUG
ENST00000259486 MI0002401 mmu-miR-466a-5p UAUGUGUGUGUACAUGUACAUA
ENST00000259486 MI0005504 mmu-miR-466b-3-3p AAUACAUACACGCACACAUAAGA
ENST00000259486 MI0005502 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENST00000259486 MI0005503 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENST00000259486 MI0005504 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENST00000259486 MI0005505 mmu-miR-466c-5p GAUGUGUGUGUGCAUGUACAUA
ENST00000259486 MI0005506 mmu-miR-466e-5p GAUGUGUGUGUACAUGUACAUA
ENST00000259486 MI0003523 mmu-miR-547 CUUGGUACAUCUUUGAGUGAG
ENST00000259486 MI0004553 mmu-miR-666-3p GGCUGCAGCGUGAUCGCCUGCU
ENST00000259486 MI0004658 mmu-miR-690 AAAGGCUAGGCUCACAACCAAA
ENST00000259486 MI0004708 mmu-miR-721 CAGUGCAAUUAAAAGGGGGAA
ENST00000259486 MI0005204 mmu-miR-805 GAAUUGAUCAGGACAUAGGG
ENST00000259486 MI0005472 mmu-miR-879 AGAGGCUUAUAGCUCUAAGCC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

[ - ] Somatic Mutations in Cancer - Sanger's COSMIC

The mutation data was obtained from the Sanger Institute Catalogue Of Somatic Mutations In Cancer web site, http://www.sanger.ac.uk/cosmic Bamford et al (2004) The COSMIC (Catalogue of Somatic Mutations in Cancer) database and website. Br J Cancer, 91,355-358.
Mutation (top 10)Total Observations
c.2562C>T1
Primary Site / Histology (Top 10)Mutations (sites * observations)
kidney / carcinoma1

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
bexarotene
  • bexarotene results in decreased expression of ENPP2 mRNA
16648578
bisphenol A
  • bisphenol A results in decreased expression of ENPP2 mRNA
12075121
Carbon Tetrachloride
  • Carbon Tetrachloride does not affect the expression of ENPP2 mRNA
  • Carbon Tetrachloride results in increased activity of ENPP2 protein
17850827
Clofibrate
  • Clofibrate results in increased expression of ENPP2 mRNA
15585944
Dimethylnitrosamine
  • Dimethylnitrosamine results in decreased expression of ENPP2 mRNA
17072980
Estradiol
  • Estradiol affects the expression of ENPP2 mRNA
14699072
Ethanol
  • Ethanol results in increased expression of ENPP2 mRNA
15353170
Ethinyl Estradiol
  • Ethinyl Estradiol affects the expression of ENPP2 mRNA
17555576
Ethinyl Estradiol
  • Ethinyl Estradiol results in decreased expression of ENPP2 mRNA
17557909, 15901920, 16174780, 15834898, 12075121, 15576828
Ethinyl Estradiol
  • Ethinyl Estradiol results in decreased expression of ENPP2 mRNA
16174780
Genistein
  • Genistein results in decreased expression of ENPP2 mRNA
12075121
Genistein
  • Genistein results in decreased expression of ENPP2 mRNA
15256057
Methapyrilene
  • Methapyrilene results in decreased expression of ENPP2 mRNA
16393664
Methylnitronitrosoguanidine
  • Methylnitronitrosoguanidine results in increased expression of ENPP2 mRNA
15120970
Progesterone
  • Progesterone affects the expression of ENPP2 mRNA
17251523
Raloxifene
  • Raloxifene affects the expression of ENPP2 mRNA
14699072
Tamoxifen
  • Tamoxifen affects the expression of ENPP2 mRNA
17555576
Tetrachlorodibenzodioxin
  • Tetrachlorodibenzodioxin results in increased expression of ENPP2 mRNA
16960034, 16054898
Tetrachlorodibenzodioxin
  • Tetrachlorodibenzodioxin results in increased expression of ENPP2 mRNA
16960034
Trichloroethylene
  • Trichloroethylene results in increased expression of ENPP2 mRNA
17905399

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Hepatitis marker 17850827
Liver Cirrhosis, Experimental marker 17072980
Breast Neoplasms inferred via Trichloroethylene 15986119
Adenoma, Liver Cell inferred via Tetrachlorodibenzodioxin 16835633
Carcinoma inferred via Tetrachlorodibenzodioxin 16835633
Cholangiocarcinoma inferred via Tetrachlorodibenzodioxin 16835633
Cleft Palate inferred via Tetrachlorodibenzodioxin 8697196
Diabetes Mellitus, Type 2 inferred via Tetrachlorodibenzodioxin 17107852
Hydronephrosis inferred via Tetrachlorodibenzodioxin 8697196
Liver Neoplasms inferred via Tetrachlorodibenzodioxin 16984957
Breast Neoplasms inferred via Tamoxifen 16202921, 15565566, 15668708, 17440819, 17893378, 17261762, 17049068, 16873071, 16818667, 11161223, 17242785
Carcinoma, Hepatocellular inferred via Tamoxifen 16924424
Carcinoma, Transitional Cell inferred via Tamoxifen 17572228
Endometrial Neoplasms inferred via Tamoxifen 16202921, 17893378
Fatty Liver inferred via Tamoxifen 14986274
Female Urogenital Diseases inferred via Tamoxifen 16709447
Lipidoses inferred via Tamoxifen 15342952
Liver Cirrhosis, Experimental inferred via Tamoxifen 18564211
Liver Neoplasms inferred via Tamoxifen 16684651
Mammary Neoplasms, Experimental inferred via Tamoxifen 11731420, 14580682, 16827153
Melanoma inferred via Tamoxifen 12393984
Melanoma, Amelanotic inferred via Tamoxifen 15990972
Spermatocele inferred via Tamoxifen 16709447
Urinary Bladder Neoplasms inferred via Tamoxifen 16712894, 17572228
Albuminuria inferred via Raloxifene 17308373, 17451421
Alzheimer Disease inferred via Raloxifene 15800139
Brain Injuries inferred via Raloxifene 16580743
Breast Neoplasms inferred via Raloxifene 17242785, 15758505, 17595753, 16837676, 15775269, 17440819, 16912660, 17893378, 17952589, 17261762, 15572757, 17049068
Carcinoma, Transitional Cell inferred via Raloxifene 17572228
Cardiovascular Diseases inferred via Raloxifene 15775269
Cognition Disorders inferred via Raloxifene 15800139
Depressive Disorder, Major inferred via Raloxifene 17474826
Diabetic Nephropathies inferred via Raloxifene 17308373, 15920148, 17451421
Edema inferred via Raloxifene 15860553
Encephalomyelitis, Autoimmune, Experimental inferred via Raloxifene 15845917
Fatty Liver inferred via Raloxifene 17473493
Heart Diseases inferred via Raloxifene 11110106
Hypertension inferred via Raloxifene 15787275, 17577099
Leiomyoma inferred via Raloxifene 16973256
Mixed Tumor, Mullerian inferred via Raloxifene 15863610
Multiple Myeloma inferred via Raloxifene 16497877
Myxoma inferred via Raloxifene 16343187
Osteoporosis inferred via Raloxifene 15775268, 17882678
Osteoporosis, Postmenopausal inferred via Raloxifene 15758505, 15579764, 17823083, 17893378
Prostatic Neoplasms inferred via Raloxifene 16220300, 16536755, 15731164
Purpura inferred via Raloxifene 15770314
Stroke inferred via Raloxifene 16837676
Urinary Bladder Neoplasms inferred via Raloxifene 17572228
Venous Thromboembolism inferred via Raloxifene 16837676
Vulvar Neoplasms inferred via Raloxifene 16343187
Brain Hemorrhage, Traumatic inferred via Progesterone 17868700
Brain Injuries inferred via Progesterone 15665606, 15845082, 15380490
Breast Neoplasms inferred via Progesterone 17614352, 16175315, 15562024
Diabetic Neuropathies inferred via Progesterone 17187935
Encephalomyelitis, Autoimmune, Experimental inferred via Progesterone 17692515
Endometriosis inferred via Progesterone 16134523
Mammary Neoplasms, Experimental inferred via Progesterone 17203775, 11408345
Ovarian Neoplasms inferred via Progesterone 17393432, 16525653
Salivary Gland Neoplasms inferred via Progesterone 18045962
Spinal Cord Injuries inferred via Progesterone 15862959, 16503802
Microsatellite Instability inferred via Methylnitronitrosoguanidine 17671175
Liver Neoplasms inferred via Methapyrilene 15890375
Breast Neoplasms inferred via Genistein 17200150, 16541309, 16873071
Carcinoma, Hepatocellular inferred via Genistein 16924424
Cardiovascular Diseases inferred via Genistein 16332659
Colonic Neoplasms inferred via Genistein 17182828
Diabetes Mellitus, Type 2 inferred via Genistein 16647724
Endometrial Hyperplasia inferred via Genistein 16402032
Glioblastoma inferred via Genistein 16598420
Liver Cirrhosis, Experimental inferred via Genistein 17823541
Mammary Neoplasms, Experimental inferred via Genistein 14578162, 12929590
Myocardial Infarction inferred via Genistein 17141266
Myocardial Reperfusion Injury inferred via Genistein 17141266
Osteoporosis, Postmenopausal inferred via Genistein 16169203
Prostatic Neoplasms inferred via Genistein 16925846, 15378649, 15256057
Acne Vulgaris inferred via Ethinyl Estradiol 17505938
Adenocarcinoma inferred via Ethinyl Estradiol 14692618
Arteriosclerosis inferred via Ethinyl Estradiol 11256880
Arthritis, Experimental inferred via Ethinyl Estradiol 15885639
Cholestasis inferred via Ethinyl Estradiol 17110522, 16105132, 11677210, 15861022, 17333356, 16919318, 17681005
Encephalomyelitis, Autoimmune, Experimental inferred via Ethinyl Estradiol 12538720
Fatty Liver inferred via Ethinyl Estradiol 15345470
Hypospadias inferred via Ethinyl Estradiol 16569931, 16945680
Infertility, Female inferred via Ethinyl Estradiol 12013081
Infertility, Male inferred via Ethinyl Estradiol 17937319
Panic Disorder inferred via Ethinyl Estradiol 11578682
Pruritus inferred via Ethinyl Estradiol 16919318, 15861022
Spermatocele inferred via Ethinyl Estradiol 16709447
Thrombophilia inferred via Ethinyl Estradiol 11994571
Thrombosis inferred via Ethinyl Estradiol 15669648
Uterine Neoplasms inferred via Ethinyl Estradiol 14692618
Venous Thrombosis inferred via Ethinyl Estradiol 15869587
Burns inferred via Ethanol 16374292
Carcinoma, Hepatocellular inferred via Ethanol 15763234, 15289165
Esophageal Neoplasms inferred via Ethanol 16704527
Fatty Liver inferred via Ethanol 16409862
Fatty Liver, Alcoholic inferred via Ethanol 17920746
Fetal Alcohol Syndrome inferred via Ethanol 16946407
Hepatitis, Toxic inferred via Ethanol 11566570
Liver Cirrhosis inferred via Ethanol 15289165
Liver Cirrhosis, Alcoholic inferred via Ethanol 18295389
Liver Cirrhosis, Experimental inferred via Ethanol 18166357
Liver Diseases, Alcoholic inferred via Ethanol 17207112, 17347304
Breast Neoplasms inferred via Estradiol 17289903, 18497071, 12948864, 17261762, 17018787, 14630087
Candidiasis, Vulvovaginal inferred via Estradiol 16111702
Carcinoma, Hepatocellular inferred via Estradiol 16924424
Herpes Genitalis inferred via Estradiol 15709030
Hot Flashes inferred via Estradiol 17088409
Insulin Resistance inferred via Estradiol 16393666, 16627594
Kidney Diseases inferred via Estradiol 15618244
Kidney Neoplasms inferred via Estradiol 15610895
Liver Cirrhosis, Experimental inferred via Estradiol 14716833, 14659978
Mammary Neoplasms, Experimental inferred via Estradiol 17203775, 11408345, 16891317, 11807958
Myocardial Reperfusion Injury inferred via Estradiol 16810080
Neovascularization, Pathologic inferred via Estradiol 17289903
Prostatic Neoplasms inferred via Estradiol 16740699
Adenocarcinoma inferred via Dimethylnitrosamine 16033868
Carcinoma, Squamous Cell inferred via Dimethylnitrosamine 16033868
Esophageal Neoplasms inferred via Dimethylnitrosamine 17016578
Liver Cirrhosis, Experimental inferred via Dimethylnitrosamine 17203207, 16570917, 14659978, 17196135, 15339415, 17432682, 17198567, 15086199, 15733078, 16009107, 18637143, 18672772, 15067225, 17640959, 18364076, 15369754, 15099470, 14709902, 15577212, 15504291, 17666798, 15138612, 16603200, 17724770, 15723089, 14726149, 16627068, 15942678, 15744066, 15591649, 18239293, 16270385, 17881167, 15492853, 18629640, 15864749, 15763062, 16544323, 15842777, 15793283, 18371158, 12925901, 15366600, 17348192, 17201889, 18237412, 17719030, 15081153, 16169303, 14643895, 18567088, 15798949, 15571005, 15161499, 12918455, 15298665, 16042886, 15479170, 15383259, 14568256, 18095165, 18210741, 17036385, 17465448, 17534399
Liver Failure, Acute inferred via Dimethylnitrosamine 17457977
Liver Neoplasms inferred via Dimethylnitrosamine 3113478, 15890375
Liver Neoplasms, Experimental inferred via Dimethylnitrosamine 15603536
Lung Neoplasms inferred via Dimethylnitrosamine 16061637
Stomach Neoplasms inferred via Dimethylnitrosamine 16033868
Dyslipidemias inferred via Clofibrate 16707586
Niemann-Pick Disease, Type C inferred via Clofibrate 9802331
Carbon Tetrachloride Poisoning inferred via Carbon Tetrachloride 16192424, 15673190, 16011737, 15700767, 16124888, 16227642, 10355542, 16097048, 16050911
Fatty Liver inferred via Carbon Tetrachloride 16045604, 17595544, 15959796, 16239168, 12795759, 61145, 12631006
Hepatitis, Toxic inferred via Carbon Tetrachloride 17522070, 16177239, 15027814, 15968718, 16227642, 15998439, 11566570
Hyperbilirubinemia inferred via Carbon Tetrachloride 16899240
Liver Cirrhosis inferred via Carbon Tetrachloride 17174718, 16221502, 17334410, 16239168, 16943688
Liver Cirrhosis, Experimental inferred via Carbon Tetrachloride 16192424, 16116963, 17525996, 17557913, 15673190, 12649538, 17721639, 18277467, 18205269, 14716496, 15730626, 12632514, 15052691, 18251166, 17823541, 17944888, 18395914, 18279442, 16027843, 15996030, 16033810, 17565644, 18376398, 12389079, 18187930, 18210741, 16015684, 12741479, 14724832, 18472094, 15931870, 17698563, 15893842, 12958196, 17640975, 18412020, 17714472, 14512876, 12609069, 18166357, 17922224, 18420326, 15876570, 12445421, 12445418, 15959796, 12898905, 18317297, 17761835, 14620537, 18472332, 14716833, 16136751, 17481882, 17900296, 15123356, 18339082, 18429990, 12546737, 18006644, 18481824, 15057751, 12586293, 18054572, 10355542, 16011737, 17869086, 17708605, 12667390, 14748882, 13678700, 15818738, 17631135, 16097048, 12632512, 17766677, 18418968, 12666154, 16638106, 18395095, 18156304, 17976157, 17805973, 16248980, 15925388
Liver Diseases inferred via Carbon Tetrachloride 16246199, 16964402, 17285989, 15830285, 15720792
Liver Failure inferred via Carbon Tetrachloride 15123358
Liver Failure, Acute inferred via Carbon Tetrachloride 14706259, 16899240
Liver Neoplasms, Experimental inferred via Carbon Tetrachloride 15583823
Breast Neoplasms inferred via bisphenol A 17123778
Carcinoma in Situ inferred via bisphenol A 17123778
Insulin Resistance inferred via bisphenol A 16393666
Prostatic Neoplasms inferred via bisphenol A 16740699
Substance-Related Disorders inferred via bisphenol A 16684133, 16045194
Uterine Diseases inferred via bisphenol A 14652134
Breast Neoplasms inferred via bexarotene 16818667, 16344269
Carcinoma, Non-Small-Cell Lung inferred via bexarotene 16247446
Lung Neoplasms inferred via bexarotene 17849452
Lymphoma, T-Cell, Cutaneous inferred via bexarotene 11161223
Mammary Neoplasms, Experimental inferred via bexarotene 15591091

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Tokumura A, et al. (2009) "Altered activity of lysophospholipase D, which produces bioactive lysophosphatidic acid and choline, in serum from women with pathological pregnancy." Mol Hum Reprod. 15(5):301-310. PMID:19297419
  2. [ + ] Haga A, et al. (2009) "Autotaxin promotes the expression of matrix metalloproteinase-3 via activation of the MAPK cascade in human fibrosarcoma HT-1080 cells." Cancer Invest. 27(4):384-390. PMID:19212832
  3. [ + ] Li S, et al. (2009) "Lipopolysaccharide induces autotaxin expression in human monocytic THP-1 cells." Biochem Biophys Res Commun. 378(2):264-268. PMID:19027716
  4. [ + ] Kanda H, et al. (2008) "Autotaxin, an ectoenzyme that produces lysophosphatidic acid, promotes the entry of lymphocytes into secondary lymphoid organs." Nat Immunol. 9(4):415-423. PMID:18327261
  5. [ + ] Haga A, et al. (2008) "Scalable purification and characterization of the extracellular domain of human autotaxin from prokaryotic cells." Protein Expr Purif. 59(1):9-17. PMID:18249559
  6. [ + ] Giganti A, et al. (2008) "Murine and human autotaxin alpha, beta, and gamma isoforms: gene organization, tissue distribution, and biochemical characterization." J Biol Chem. 283(12):7776-7789. PMID:18175805
  7. [ + ] Khurana S, et al. (2008) "Autotaxin and lysophosphatidic acid stimulate intestinal cell motility by redistribution of the actin modifying protein villin to the developing lamellipodia." Exp Cell Res. 314(3):530-542. PMID:18054784
  8. [ + ] Seifert A, et al. (2008) "The cellular localization of autotaxin impacts on its biological functions in human thyroid carcinoma cells." Oncol Rep. 19(6):1485-1491. PMID:18497954
  9. [ + ] Ptaszynska MM, et al. (2008) "Positive feedback between vascular endothelial growth factor-A and autotaxin in ovarian cancer cells." Mol Cancer Res. 6(3):352-363. PMID:18337445
  10. [ + ] Cooper AB, et al. (2007) "Is autotaxin (ENPP2) the link between hepatitis C and hepatocellular cancer?" J Gastrointest Surg. 11(12):1628-34; discussion 1634. PMID:17902023
  11. [ + ] Ganguly K, et al. (2007) "Candidate genes controlling pulmonary function in mice: transcript profiling and predicted protein structure." Physiol Genomics. 31(3):410-421. PMID:17804602
  12. [ + ] Watanabe N, et al. (2007) "Both plasma lysophosphatidic acid and serum autotaxin levels are increased in chronic hepatitis C." J Clin Gastroenterol. 41(6):616-623. PMID:17577119
  13. [ + ] Kishi Y, et al. (2006) "Autotaxin is overexpressed in glioblastoma multiforme and contributes to cell motility of glioblastoma by converting lysophosphatidylcholine to lysophosphatidic acid." J Biol Chem. 281(25):17492-17500. PMID:16627485
  14. [ + ] Umemura K, et al. (2006) "Autotaxin expression is enhanced in frontal cortex of Alzheimer-type dementia patients." Neurosci Lett. 400(1-2):97-100. PMID:16529861
  15. [ + ] Koike S, et al. (2006) "The N-terminal hydrophobic sequence of autotaxin (ENPP2) functions as a signal peptide." Genes Cells. 11(2):133-142. PMID:16436050
  16. [ + ] Kimura K, et al. (2006) "Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes." Genome Res. 16(1):55-65. PMID:16344560
  17. [ + ] Song J, et al. (2006) "The candidate tumor suppressor CST6 alters the gene expression profile of human breast carcinoma cells: down-regulation of the potent mitogenic, motogenic, and angiogenic factor autotaxin." Biochem Biophys Res Commun. 340(1):175-182. PMID:16356477
  18. [ + ] Lee J, et al. (2006) "Autotaxin stimulates urokinase-type plasminogen activator expression through phosphoinositide 3-kinase-Akt-nuclear [corrected] factor kappa B signaling cascade in human melanoma cells." Melanoma Res. 16(5):445-452. PMID:17013094
  19. [ + ] van Meeteren LA, et al. (2006) "Autotaxin, a secreted lysophospholipase D, is essential for blood vessel formation during development." Mol Cell Biol. 26(13):5015-5022. PMID:16782887
  20. [ + ] Baumforth KR, et al. (2005) "Induction of autotaxin by the Epstein-Barr virus promotes the growth and survival of Hodgkin lymphoma cells." Blood. 106(6):2138-2146. PMID:15933052
  21. [ + ] Boucher J, et al. (2005) "Potential involvement of adipocyte insulin resistance in obesity-associated up-regulation of adipocyte lysophospholipase D/autotaxin expression." Diabetologia. 48(3):569-577. PMID:15700135
  22. [ + ] van Meeteren LA, et al. (2005) "Inhibition of autotaxin by lysophosphatidic acid and sphingosine 1-phosphate." J Biol Chem. 280(22):21155-21161. PMID:15769751
  23. [ + ] Chen M, et al. (2005) "Integrin alpha6beta4 promotes expression of autotaxin/ENPP2 autocrine motility factor in breast carcinoma cells." Oncogene. 24(32):5125-5130. PMID:15897878
  24. [ + ] Jansen S, et al. (2005) "Proteolytic maturation and activation of autotaxin (NPP2), a secreted metastasis-enhancing lysophospholipase D." J Cell Sci. 118(Pt 14):3081-3089. PMID:15985467
  25. [ + ] Mazereeuw-Hautier J, et al. (2005) "Production of lysophosphatidic acid in blister fluid: involvement of a lysophospholipase D activity." J Invest Dermatol. 125(3):421-427. PMID:16117781
  26. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  27. [ + ] Kehlen A, et al. (2004) "Expression, regulation and function of autotaxin in thyroid carcinomas." Int J Cancer. 109(6):833-838. PMID:15027116
  28. [ + ] Gijsbers R, et al. (2003) "The hydrolysis of lysophospholipids and nucleotides by autotaxin (NPP2) involves a single catalytic site." FEBS Lett. 538(1-3):60-64. PMID:12633853
  29. [ + ] Koh E, et al. (2003) "Site-directed mutations in the tumor-associated cytokine, autotaxin, eliminate nucleotide phosphodiesterase, lysophospholipase D, and motogenic activities." Cancer Res. 63(9):2042-2045. PMID:12727817
  30. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  31. [ + ] Yang SY, et al. (2002) "Expression of autotaxin (NPP-2) is closely linked to invasiveness of breast cancer cells." Clin Exp Metastasis. 19(7):603-608. PMID:12498389
  32. [ + ] Jung ID, et al. (2002) "Cdc42 and Rac1 are necessary for autotaxin-induced tumor cell motility in A2058 melanoma cells." FEBS Lett. 532(3):351-356. PMID:12482591
  33. [ + ] Tokumura A, et al. (2002) "Identification of human plasma lysophospholipase D, a lysophosphatidic acid-producing enzyme, as autotaxin, a multifunctional phosphodiesterase." J Biol Chem. 277(42):39436-39442. PMID:12176993
  34. [ + ] Umezu-Goto M, et al. (2002) "Autotaxin has lysophospholipase D activity leading to tumor cell growth and motility by lysophosphatidic acid production." J Cell Biol. 158(2):227-233. PMID:12119361
  35. [ + ] Nam SW, et al. (2001) "Autotaxin (NPP-2), a metastasis-enhancing motogen, is an angiogenic factor." Cancer Res. 61(18):6938-6944. PMID:11559573
  36. [ + ] Dias Neto E, et al. (2000) "Shotgun sequencing of the human transcriptome with ORF expressed sequence tags." Proc Natl Acad Sci U S A. 97(7):3491-3496. PMID:10737800
  37. [ + ] Clair T, et al. (1997) "Autotaxin is an exoenzyme possessing 5'-nucleotide phosphodiesterase/ATP pyrophosphatase and ATPase activities." J Biol Chem. 272(2):996-1001. PMID:8995394
  38. [ + ] Lee HY, et al. (1996) "Stimulation of tumor cell motility linked to phosphodiesterase catalytic site of autotaxin." J Biol Chem. 271(40):24408-24412. PMID:8798697
  39. [ + ] Lee HY, et al. (1996) "Cloning, chromosomal localization, and tissue expression of autotaxin from human teratocarcinoma cells." Biochem Biophys Res Commun. 218(3):714-719. PMID:8579579
  40. [ + ] Bonaldo MF, et al. (1996) "Normalization and subtraction: two approaches to facilitate gene discovery." Genome Res. 6(9):791-806. PMID:8889548
  41. [ + ] Stracke ML, et al. (1995) "Autotaxin is an N-linked glycoprotein but the sugar moieties are not needed for its stimulation of cellular motility." Melanoma Res. 5(4):203-209. PMID:7496154
  42. [ + ] Kawagoe H, et al. (1995) "Molecular cloning and chromosomal assignment of the human brain-type phosphodiesterase I/nucleotide pyrophosphatase gene (PDNP2)." Genomics. 30(2):380-384. PMID:8586446
  43. [ + ] Murata J, et al. (1994) "cDNA cloning of the human tumor motility-stimulating protein, autotaxin, reveals a homology with phosphodiesterases." J Biol Chem. 269(48):30479-30484. PMID:7982964
  44. [ + ] Stracke ML, et al. (1992) "Identification, purification, and partial sequence analysis of autotaxin, a novel motility-stimulating protein." J Biol Chem. 267(4):2524-2529. PMID:1733949