ABHD10 | GeneID:515563 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 515563 Official Symbol ABHD10
Locus N/A Gene Type protein-coding
Synonyms MGC137541
Full Name N/A
Description abhydrolase domain containing 10
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 10173

ID Symbol Protein Species
GeneID:55347 ABHD10 NP_060864.1 Homo sapiens
GeneID:213012 Abhd10 NP_766099.2 Mus musculus
GeneID:303953 Abhd10 XP_001064579.1 Rattus norvegicus
GeneID:418419 ABHD10 XP_416633.2 Gallus gallus
GeneID:478561 ABHD10 XP_535737.2 Canis lupus familiaris
GeneID:515563 ABHD10 NP_001015606.1 Bos taurus
GeneID:563031 LOC563031 XP_691488.2 Danio rerio
GeneID:568517 wu:fb10b08 XP_696942.2 Danio rerio
GeneID:743016 ABHD10 XP_001154093.1 Pan troglodytes

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005739 Component mitochondrion
GO:0008233 Function peptidase activity
GO:0008236 Function serine-type peptidase activity

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001015606 NP_001015606

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000006038 MI0005026 bta-let-7d AGAGGUAGUAGGUUGCAUAGUU
ENSBTAT00000006038 MI0005455 bta-let-7e UGAGGUAGGAGGUUGUAUAGU
ENSBTAT00000006038 MI0005011 bta-miR-142 CAUAAAGUAGAAAGCACUAC
ENSBTAT00000006038 MI0004742 bta-miR-21* AACAGCAGUCGAUGGGCUGUCU
ENSBTAT00000006038 MI0005017 bta-miR-218 UUGUGCUUGAUCUAACCAUGU
ENSBTAT00000006038 MI0005054 bta-miR-30a-5p UGUAAACAUCCUCGACUGGAAGCU
ENSBTAT00000006038 MI0004761 bta-miR-30b UGUAAACAUCCUACACUCAGCU
ENSBTAT00000006038 MI0005064 bta-miR-30c UGUAAACAUCCUACACUCUCAGC
ENSBTAT00000006038 MI0004747 bta-miR-30d UGUAAACAUCCCCGACUGGAAGCU
ENSBTAT00000006038 MI0005018 bta-miR-30e-5p UGUAAACAUCCUUGACUGGAAGCU
ENSBTAT00000006038 MI0005023 bta-miR-545* UCAGUAAAUGUUUAUUGGAUG
ENSBTAT00000006038 MI0004998 gga-miR-460 CCUGCAUUGUACACACUGUGUG
ENSBTAT00000006038 MI0000454 hsa-miR-137 UUAUUGCUUAAGAAUACGCGUAG
ENSBTAT00000006038 MI0000463 hsa-miR-153 UUGCAUAGUCACAAAAGUGAUC
ENSBTAT00000006038 MI0000464 hsa-miR-153 UUGCAUAGUCACAAAAGUGAUC
ENSBTAT00000006038 MI0000293 hsa-miR-217 UACUGCAUCAGGAACUGAUUGGA
ENSBTAT00000006038 MI0000791 hsa-miR-383 AGAUCAGAAGGUGAUUGUGGCU
ENSBTAT00000006038 MI0002469 hsa-miR-485-3p GUCAUACACGGCUCUCCUCUCU
ENSBTAT00000006038 MI0003142 hsa-miR-498 UUUCAAGCCAGGGGGCGUUUUUC
ENSBTAT00000006038 MI0003161 hsa-miR-517a AUCGUGCAUCCCUUUAGAGUGU
ENSBTAT00000006038 MI0003151 hsa-miR-519b-3p AAAGUGCAUCCUUUUAGAGGUU
ENSBTAT00000006038 MI0003164 hsa-miR-520d-5p CUACAAAGGGAAGCCCUUUC
ENSBTAT00000006038 MI0003583 hsa-miR-576-5p AUUCUAAUUUCUCCACGUCUUU
ENSBTAT00000006038 MI0003586 hsa-miR-579 UUCAUUUGGUAUAAACCGCGAUU
ENSBTAT00000006038 MI0003602 hsa-miR-590-3p UAAUUUUAUGUAUAAGCUAGU
ENSBTAT00000006038 MI0003604 hsa-miR-592 UUGUGUCAAUAUGCGAUGAUGU
ENSBTAT00000006038 MI0003609 hsa-miR-597 UGUGUCACUCGAUGACCACUGU
ENSBTAT00000006038 MI0003610 hsa-miR-598 UACGUCAUCGUUGUCAUCGUCA
ENSBTAT00000006038 MI0003611 hsa-miR-599 GUUGUGUCAGUUUAUCAAAC
ENSBTAT00000006038 MI0003639 hsa-miR-625 AGGGGGAAAGUUCUAUAGUCC
ENSBTAT00000006038 MI0003658 hsa-miR-643 ACUUGUAUGCUAGCUCAGGUAG
ENSBTAT00000006038 MI0003661 hsa-miR-646 AAGCAGCUGCCUCUGAGGC
ENSBTAT00000006038 MI0005560 hsa-miR-885-5p UCCAUUACACUACCCUGCCUCU
ENSBTAT00000006038 MI0000388 mmu-miR-290-5p ACUCAAACUAUGGGGGCACUUU
ENSBTAT00000006038 MI0002400 mmu-miR-465a-3p GAUCAGGGCCUUUCUAAGUAGA
ENSBTAT00000006038 MI0004671 mmu-miR-467b GUAAGUGCCUGCAUGUAUAUG
ENSBTAT00000006038 MI0006128 mmu-miR-467e AUAAGUGUGAGCAUGUAUAUGU
ENSBTAT00000006038 MI0004687 mmu-miR-703 AAAACCUUCAGAAGGAAAGAA
ENSBTAT00000006038 MI0004694 mmu-miR-710 CCAAGUCUUGGGGAGAGUUGAG
ENSBTAT00000006038 MI0005207 mmu-miR-743a GAAAGACACCAAGCUGAGUAGA
ENSBTAT00000006038 MI0005470 mmu-miR-743b-3p GAAAGACAUCAUGCUGAAUAGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Harhay GP, et al. (2005) "Characterization of 954 bovine full-CDS cDNA sequences." BMC Genomics. 6():166. PMID:16305752
  2. [ + ] Smith TP, et al. (2001) "Sequence evaluation of four pooled-tissue normalized bovine cDNA libraries and construction of a gene index for cattle." Genome Res. 11(4):626-630. PMID:11282978