ABCG5 | GeneID:515536 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 515536 Official Symbol ABCG5
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family G (WHITE), member 5
Chromosome N/A
Also Known As ATP-binding cassette sub-family G member 5; ATP-binding cassette, sub-family G (WHITE), member 5 (sterolin 1)
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 31909

ID Symbol Protein Species
GeneID:27409 Abcg5 NP_114090.1 Mus musculus
GeneID:42976 CG11069 NP_651307.2 Drosophila melanogaster
GeneID:64240 ABCG5 NP_071881.1 Homo sapiens
GeneID:114628 Abcg5 NP_446206.2 Rattus norvegicus
GeneID:421401 ABCG5 XP_419457.2 Gallus gallus
GeneID:481354 ABCG5 XP_538475.1 Canis lupus familiaris
GeneID:515536 ABCG5 NP_001019718.1 Bos taurus
GeneID:557317 LOC557317 XP_684646.1 Danio rerio
GeneID:1281061 AgaP_AGAP002051 XP_320996.2 Anopheles gambiae

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0045177 Component apical part of cell
GO:0016020 Component membrane
GO:0005624 Component membrane fraction
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001024547 NP_001019718

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000021768 MI0005035 bta-miR-192 CUGACCUAUGAAUUGACAGCCAG
ENSBTAT00000021768 MI0005016 bta-miR-215 AUGACCUAUGAAUUGACAGACA
ENSBTAT00000021768 MI0005047 bta-miR-425-5p AUGACACGAUCACUCCCGUUGA
ENSBTAT00000021768 MI0005056 bta-miR-7 UGGAAGACUAGUGAUUUUGUUGUU
ENSBTAT00000021768 MI0000086 hsa-miR-28-5p AAGGAGCUCACAGUCUAUUGAG
ENSBTAT00000021768 MI0000786 hsa-miR-378 ACUGGACUUGGAGUCAGAAGG
ENSBTAT00000021768 MI0001444 hsa-miR-422a ACUGGACUUAGGGUCAGAAGGC
ENSBTAT00000021768 MI0001729 hsa-miR-451 AAACCGUUACCAUUACUGAGUU
ENSBTAT00000021768 MI0003125 hsa-miR-490-5p CCAUGGAUCUCCAGGUGGGU
ENSBTAT00000021768 MI0003140 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENSBTAT00000021768 MI0003141 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENSBTAT00000021768 MI0003587 hsa-miR-580 UUGAGAAUGAUGAAUCAUUAGG
ENSBTAT00000021768 MI0003589 hsa-miR-582-5p UUACAGUUGUUCAACCAGUUACU
ENSBTAT00000021768 MI0003613 hsa-miR-600 ACUUACAGACAAGAGCCUUGCUC
ENSBTAT00000021768 MI0003619 hsa-miR-606 AAACUACUGAAAAUCAAAGAU
ENSBTAT00000021768 MI0003650 hsa-miR-635 ACUUGGGCACUGAAACAAUGUCC
ENSBTAT00000021768 MI0003659 hsa-miR-644 AGUGUGGCUUUCUUAGAGC
ENSBTAT00000021768 MI0005543 hsa-miR-708 AAGGAGCUUACAAUCUAGCUGGG
ENSBTAT00000021768 MI0003906 hsa-miR-802 CAGUAACAAAGAUUCAUCCUUGU
ENSBTAT00000021768 MI0005769 hsa-miR-944 AAAUUAUUGUACAUCGGAUGAG
ENSBTAT00000021768 MI0001526 mmu-miR-434-3p UUUGAACCAUCACUCGACUCCU
ENSBTAT00000021768 MI0002399 mmu-miR-464 UACCAAGUUUAUUCUGUGAGAUA
ENSBTAT00000021768 MI0003518 mmu-miR-540-5p CAAGGGUCACCCUCUGACUCUGU
ENSBTAT00000021768 MI0004634 mmu-miR-677 UUCAGUGAUGAUUAGCUUCUGA
ENSBTAT00000021768 MI0004681 mmu-miR-697 AACAUCCUGGUCCUGUGGAGA
ENSBTAT00000021768 MI0004691 mmu-miR-707 CAGUCAUGCCGCUUGCCUACG
ENSBTAT00000021768 MI0005477 mmu-miR-883b-5p UACUGAGAAUGGGUAGCAGUCA
ENSBTAT00000021768 MI0000635 rno-miR-347 UGUCCCUCUGGGUCGCCCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Viturro E, et al. (2006) "Identification, sequence analysis and mRNA tissue distribution of the bovine sterol transporters ABCG5 and ABCG8." J Dairy Sci. 89(2):553-561. PMID:16428624