ABCC4 | GeneID:515333 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 515333 Official Symbol ABCC4
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family C (CFTR/MRP), member 4
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 74563

ID Symbol Protein Species
GeneID:10257 ABCC4 NP_005836.2 Homo sapiens
GeneID:35163 CG31792 NP_724148.1 Drosophila melanogaster
GeneID:47905 l(2)03659 NP_610482.2 Drosophila melanogaster
GeneID:170924 Abcc4 NP_596902.1 Rattus norvegicus
GeneID:180691 mrp-6 NP_508710.2 Caenorhabditis elegans
GeneID:239273 Abcc4 NP_001028508.1 Mus musculus
GeneID:368620 abcc4 NP_001007039.1 Danio rerio
GeneID:418791 ABCC4 NP_001025990.1 Gallus gallus
GeneID:452625 ABCC4 XP_001137006.1 Pan troglodytes
GeneID:485523 ABCC4 XP_542642.2 Canis lupus familiaris
GeneID:515333 ABCC4 XP_593336.2 Bos taurus
GeneID:820496 ATMRP3 NP_187915.1 Arabidopsis thaliana
GeneID:820497 ATMRP8 NP_187916.3 Arabidopsis thaliana
GeneID:820498 ATMRP7 NP_187917.3 Arabidopsis thaliana
GeneID:4327122 Os01g0173900 NP_001042159.1 Oryza sativa

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0005254 Function chloride channel activity
GO:0000166 Function nucleotide binding
GO:0006811 Process ion transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_593336 XP_593336

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000013298 MI0005027 bta-miR-124a UUAAGGCACGCGGUGAAUGCCAA
ENSBTAT00000013298 MI0005034 bta-miR-191 CAACGGAAUCCCAAAAGCAGCUG
ENSBTAT00000013298 MI0005460 bta-miR-19a UGUGCAAAUCUAUGCAAAACUGA
ENSBTAT00000013298 MI0004731 bta-miR-26a UUCAAGUAAUCCAGGAUAGGCU
ENSBTAT00000013298 MI0004745 bta-miR-26b UUCAAGUAAUUCAGGAUAGGUU
ENSBTAT00000013298 MI0005021 bta-miR-380-3p UAUGUAAUGUGGUCCACGUCU
ENSBTAT00000013298 MI0000748 hsa-miR-130b CAGUGCAAUGAUGAAAGGGCAU
ENSBTAT00000013298 MI0005570 hsa-miR-208b AUAAGACGAACAAAAGGUUUGU
ENSBTAT00000013298 MI0000745 hsa-miR-301a CAGUGCAAUAGUAUUGUCAAAGC
ENSBTAT00000013298 MI0005568 hsa-miR-301b CAGUGCAAUGAUAUUGUCAAAGC
ENSBTAT00000013298 MI0000814 hsa-miR-338-5p AACAAUAUCCUGGUGCUGAGUG
ENSBTAT00000013298 MI0003125 hsa-miR-490-3p CAACCUGGAGGACUCCAUGCUG
ENSBTAT00000013298 MI0003193 hsa-miR-506 UAAGGCACCCUUCUGAGUAGA
ENSBTAT00000013298 MI0003177 hsa-miR-522 AAAAUGGUUCCCUUUAGAGUGU
ENSBTAT00000013298 MI0003679 hsa-miR-549 UGACAACUAUGGAUGAGCUCU
ENSBTAT00000013298 MI0003610 hsa-miR-598 UACGUCAUCGUUGUCAUCGUCA
ENSBTAT00000013298 MI0003641 hsa-miR-627 GUGAGUCUCUAAGAAAAGAGGA
ENSBTAT00000013298 MI0005534 hsa-miR-891b UGCAACUUACCUGAGUCAUUGA
ENSBTAT00000013298 MI0004295 mmu-miR-670 AUCCCUGAGUGUAUGUGGUGAA
ENSBTAT00000013298 MI0004708 mmu-miR-721 CAGUGCAAUUAAAAGGGGGAA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_593336  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene