ABCD1 | GeneID:515178 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 515178 Official Symbol ABCD1
Locus N/A Gene Type protein-coding
Synonyms MGC129031
Full Name N/A
Description ATP-binding cassette, sub-family D (ALD), member 1
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 55426

ID Symbol Protein Species
GeneID:215 ABCD1 NP_000024.2 Homo sapiens
GeneID:11666 Abcd1 NP_031461.1 Mus musculus
GeneID:363516 Abcd1 XP_343841.1 Rattus norvegicus
GeneID:515178 ABCD1 NP_001039655.1 Bos taurus
GeneID:566367 zgc:172102 NP_001104656.1 Danio rerio
GeneID:612520 ABCD1 XP_855341.1 Canis lupus familiaris
GeneID:2684880 MGG_06707 XP_370210.2 Magnaporthe grisea
GeneID:2709950 NCU01751.1 XP_328190.1 Neurospora crassa

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0005778 Component peroxisomal membrane
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0005515 Function protein binding
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001046190 NP_001039655

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000027382 MI0004743 bta-miR-221 AGCUACAUUGUCUGCUGGGUUU
ENSBTAT00000027382 MI0005068 bta-miR-34c AGGCAGUGUAGUUAGCUGAUUG
ENSBTAT00000027382 MI0004997 gga-miR-456 CAGGCUGGUUAGAUGGUUGUCA
ENSBTAT00000027382 MI0003130 hsa-miR-202 AGAGGUAUAGGGCAUGGGAA
ENSBTAT00000027382 MI0000747 hsa-miR-296-3p GAGGGUUGGGUGGAGGCUCUCC
ENSBTAT00000027382 MI0000807 hsa-miR-323-5p AGGUGGUCCGUGGCGCGUUCGC
ENSBTAT00000027382 MI0000786 hsa-miR-378 ACUGGACUUGGAGUCAGAAGG
ENSBTAT00000027382 MI0003603 hsa-miR-591 AGACCAUGGGUUCUCAUUGU
ENSBTAT00000027382 MI0003634 hsa-miR-620 AUGGAGAUAGAUAUAGAAAU
ENSBTAT00000027382 MI0003662 hsa-miR-647 GUGGCUGCACUCACUUCCUUC
ENSBTAT00000027382 MI0004553 mmu-miR-666-5p AGCGGGCACAGCUGUGAGAGCC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene