ABHD14A | GeneID:515122 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 515122 Official Symbol ABHD14A
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description abhydrolase domain containing 14A
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 22889

ID Symbol Protein Species
GeneID:25864 ABHD14A NP_056222.1 Homo sapiens
GeneID:68644 Abhd14a NP_666031.1 Mus musculus
GeneID:176923 Y55F3AM.10 NP_500027.1 Caenorhabditis elegans
GeneID:300982 Abhd14a NP_001009670.1 Rattus norvegicus
GeneID:404598 zgc:85972 NP_996949.1 Danio rerio
GeneID:484743 ABHD14A XP_541859.2 Canis lupus familiaris
GeneID:515122 ABHD14A XP_593087.2 Bos taurus

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_593087 XP_593087

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000024785 MI0005049 bta-miR-455 UAUGUGCCUUUGGACUACAUC
ENSBTAT00000024785 MI0003129 hsa-miR-146b-3p UGCCCUGUGGACUCAGUUCUGG
ENSBTAT00000024785 MI0000262 hsa-miR-147 GUGUGUGGAAAUGCUUCUGC
ENSBTAT00000024785 MI0000292 hsa-miR-216a UAAUCUCAGCUGGCAACUGUGA
ENSBTAT00000024785 MI0000824 hsa-miR-325 CCUAGUAGGUGUCCAGUAAGUGU
ENSBTAT00000024785 MI0000804 hsa-miR-328 CUGGCCCUCUCUGCCCUUCCGU
ENSBTAT00000024785 MI0003123 hsa-miR-488 UUGAAAGGCUAUUUCUUGGUC
ENSBTAT00000024785 MI0003189 hsa-miR-504 AGACCCUGGUCUGCACUCUAUC
ENSBTAT00000024785 MI0003149 hsa-miR-520a-3p AAAGUGCUUCCCUUUGGACUGU
ENSBTAT00000024785 MI0003155 hsa-miR-520b AAAGUGCUUCCUUUUAGAGGG
ENSBTAT00000024785 MI0003158 hsa-miR-520c-3p AAAGUGCUUCCUUUUAGAGGGU
ENSBTAT00000024785 MI0003164 hsa-miR-520d-3p AAAGUGCUUCUCUUUGGUGGGU
ENSBTAT00000024785 MI0003143 hsa-miR-520e AAAGUGCUUCCUUUUUGAGGG
ENSBTAT00000024785 MI0003635 hsa-miR-621 GGCUAGCAACAGCGCUUACCU
ENSBTAT00000024785 MI0003642 hsa-miR-628-3p UCUAGUAAGAGUGGCAGUCGA
ENSBTAT00000024785 MI0003761 hsa-miR-668 UGUCACUCGGCUCGGCCCACUAC
ENSBTAT00000024785 MI0005542 hsa-miR-876-5p UGGAUUUCUUUGUGAAUCACCA
ENSBTAT00000024785 MI0000392 mmu-miR-294 AAAGUGCUUCCCUUUUGUGUGU
ENSBTAT00000024785 MI0004651 mmu-miR-719 AUCUCGGCUACAGAAAAAUGUU
ENSBTAT00000024785 MI0005548 mmu-miR-878-5p UAUCUAGUUGGAUGUCAAGACA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene