ABCE1 | GeneID:514991 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 514991 Official Symbol ABCE1
Locus N/A Gene Type protein-coding
Synonyms MGC139587
Full Name N/A
Description ATP-binding cassette, sub-family E (OABP), member 1
Chromosome N/A
Also Known As ATP-binding cassette, sub-family E, member 1
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 2205

ID Symbol Protein Species
GeneID:6059 ABCE1 NP_001035809.1 Homo sapiens
GeneID:24015 Abce1 NP_056566.2 Mus musculus
GeneID:39027 CG5651 NP_648272.1 Drosophila melanogaster
GeneID:176733 abce-1 NP_499717.1 Caenorhabditis elegans
GeneID:361390 Abce1 XP_001064797.1 Rattus norvegicus
GeneID:406324 abce1 NP_998216.1 Danio rerio
GeneID:422462 ABCE1 NP_001006440.1 Gallus gallus
GeneID:461523 ABCE1 XP_517465.1 Pan troglodytes
GeneID:475454 ABCE1 XP_532679.2 Canis lupus familiaris
GeneID:514991 ABCE1 XP_592921.3 Bos taurus
GeneID:813912 MAL13P1.344 XP_001350392.1 Plasmodium falciparum
GeneID:827661 ATRLI2 NP_193656.2 Arabidopsis thaliana
GeneID:851665 RLI1 NP_010376.1 Saccharomyces cerevisiae
GeneID:1269374 AgaP_AGAP002182 XP_308004.2 Anopheles gambiae
GeneID:2539753 SPBC14F5.06 NP_596732.1 Schizosaccharomyces pombe
GeneID:2677986 MGG_11382 XP_362155.2 Magnaporthe grisea
GeneID:2712409 NCU03061.1 XP_330497.1 Neurospora crassa
GeneID:2891913 KLLA0C17556g XP_452984.1 Kluyveromyces lactis
GeneID:4350692 Os11g0546000 NP_001068062.1 Oryza sativa
GeneID:4623093 AGOS_AGR125W NP_986791.1 Eremothecium gossypii

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001083685 NP_001077154

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000048747 MI0005057 bta-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSBTAT00000048747 MI0005451 bta-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSBTAT00000048747 MI0005452 bta-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSBTAT00000048747 MI0005454 bta-let-7c UGAGGUAGUAGGUUGUAUGGUU
ENSBTAT00000048747 MI0004734 bta-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENSBTAT00000048747 MI0005062 bta-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENSBTAT00000048747 MI0005037 bta-miR-200a UAACACUGUCUGGUAACGAUGUU
ENSBTAT00000048747 MI0005055 bta-miR-200b UAAUACUGCCUGGUAAUGAUG
ENSBTAT00000048747 MI0005038 bta-miR-200c UAAUACUGCCGGGUAAUGAUGGA
ENSBTAT00000048747 MI0005043 bta-miR-29b UAGCACCAUUUGAAAUCAGUGUUU
ENSBTAT00000048747 MI0005054 bta-miR-30a-5p UGUAAACAUCCUCGACUGGAAGCU
ENSBTAT00000048747 MI0004747 bta-miR-30d UGUAAACAUCCCCGACUGGAAGCU
ENSBTAT00000048747 MI0005018 bta-miR-30e-5p UGUAAACAUCCUUGACUGGAAGCU
ENSBTAT00000048747 MI0005025 bta-miR-98 UGAGGUAGUAAGUUGUAUUGUU
ENSBTAT00000048747 MI0000448 hsa-miR-130a CAGUGCAAUGUUAAAAGGGCAU
ENSBTAT00000048747 MI0000748 hsa-miR-130b CAGUGCAAUGAUGAAAGGGCAU
ENSBTAT00000048747 MI0000452 hsa-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
ENSBTAT00000048747 MI0000453 hsa-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
ENSBTAT00000048747 MI0000810 hsa-miR-135b UAUGGCUUUUCAUUCCUAUGUGA
ENSBTAT00000048747 MI0000457 hsa-miR-141 UAACACUGUCUGGUAAAGAUGG
ENSBTAT00000048747 MI0000681 hsa-miR-155 UUAAUGCUAAUCGUGAUAGGGGU
ENSBTAT00000048747 MI0002465 hsa-miR-410 AAUAUAACACAGAUGGCCUGU
ENSBTAT00000048747 MI0003125 hsa-miR-490-3p CAACCUGGAGGACUCCAUGCUG
ENSBTAT00000048747 MI0003126 hsa-miR-491-3p CUUAUGCAAGAUUCCCUUCUAC
ENSBTAT00000048747 MI0003142 hsa-miR-498 UUUCAAGCCAGGGGGCGUUUUUC
ENSBTAT00000048747 MI0003151 hsa-miR-519b-3p AAAGUGCAUCCUUUUAGAGGUU
ENSBTAT00000048747 MI0003148 hsa-miR-519c-3p AAAGUGCAUCUUUUUAGAGGAU
ENSBTAT00000048747 MI0003630 hsa-miR-548c-3p CAAAAAUCUCAAUUACUUUUGC
ENSBTAT00000048747 MI0003618 hsa-miR-605 UAAAUCCCAUGGUGCCUUCUCCU
ENSBTAT00000048747 MI0003619 hsa-miR-606 AAACUACUGAAAAUCAAAGAU
ENSBTAT00000048747 MI0003633 hsa-miR-619 GACCUGGACAUGUUUGUGCCCAGU
ENSBTAT00000048747 MI0003674 hsa-miR-653 GUGUUGAAACAAUCUCUACUG
ENSBTAT00000048747 MI0005755 hsa-miR-933 UGUGCGCAGGGAGACCUCUCCC
ENSBTAT00000048747 MI0003539 mmu-miR-291b-3p AAAGUGCAUCCAUUUUGUUUGU
ENSBTAT00000048747 MI0005507 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENSBTAT00000048747 MI0005508 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENSBTAT00000048747 MI0005509 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENSBTAT00000048747 MI0003523 mmu-miR-547 CUUGGUACAUCUUUGAGUGAG
ENSBTAT00000048747 MI0004664 mmu-miR-694 CUGAAAAUGUUGCCUGAAG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene