A2M | GeneID:513856 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 513856 Official Symbol A2M
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description alpha-2-macroglobulin
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 37248

ID Symbol Protein Species
GeneID:2 A2M NP_000005.2 Homo sapiens
GeneID:24153 A2m NP_036620.1 Rattus norvegicus
GeneID:232345 A2m NP_783327.1 Mus musculus
GeneID:418251 A2M XP_416476.2 Gallus gallus
GeneID:465372 A2M XP_001139819.1 Pan troglodytes
GeneID:477699 A2M XP_534893.2 Canis lupus familiaris
GeneID:513856 A2M XP_591612.3 Bos taurus
GeneID:562067 LOC562067 XP_001922903.1 Danio rerio
GeneID:569025 LOC569025 XP_697477.3 Danio rerio
GeneID:793035 zgc:171445 NP_001107101.1 Danio rerio
GeneID:793100 LOC793100 XP_001332356.1 Danio rerio
GeneID:100003785 LOC100003785 XP_001921519.1 Danio rerio
GeneID:100006782 LOC100006782 XP_001345438.2 Danio rerio
GeneID:100006895 LOC100006895 XP_001923676.1 Danio rerio
GeneID:100006925 LOC100006925 XP_001921577.1 Danio rerio
GeneID:100006947 sb:cb37 XP_001345541.2 Danio rerio
GeneID:100006972 LOC100006972 XP_001345556.2 Danio rerio
GeneID:100006993 wu:fb68b01 XP_001345569.2 Danio rerio
GeneID:100101650 zgc:165518 NP_001093623.1 Danio rerio
GeneID:100136837 zgc:171446 NP_001108028.1 Danio rerio
GeneID:100137103 zgc:171426 NP_001108172.1 Danio rerio
GeneID:100137119 si:dkey-46g23.3 NP_001108188.1 Danio rerio

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005576 Component extracellular region
GO:0005515 Function protein binding
GO:0004867 Function serine-type endopeptidase inhibitor activity

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001109795 NP_001103265

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000006167 MI0005063 bta-miR-122 UGGAGUGUGACAAUGGUGUUUG
ENSBTAT00000006167 MI0005018 bta-miR-30e-5p UGUAAACAUCCUUGACUGGAAGCU
ENSBTAT00000006167 MI0005023 bta-miR-545 AUCAACAAACAUUUAUUGUGUG
ENSBTAT00000006167 MI0005023 bta-miR-545* UCAGUAAAUGUUUAUUGGAUG
ENSBTAT00000006167 MI0000803 hsa-miR-330-3p GCAAAGCACACGGCCUGCAGAGA
ENSBTAT00000006167 MI0000783 hsa-miR-375 UUUGUUCGUUCGGCUCGCGUGA
ENSBTAT00000006167 MI0002470 hsa-miR-486-5p UCCUGUACUGAGCUGCCCCGAG
ENSBTAT00000006167 MI0003127 hsa-miR-511 GUGUCUUUUGCUCUGCAGUCA
ENSBTAT00000006167 MI0003128 hsa-miR-511 GUGUCUUUUGCUCUGCAGUCA
ENSBTAT00000006167 MI0003140 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENSBTAT00000006167 MI0003141 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENSBTAT00000006167 MI0003159 hsa-miR-518c CAAAGCGCUUCUCUUUAGAGUGU
ENSBTAT00000006167 MI0003558 hsa-miR-553 AAAACGGUGAGAUUUUGUUUU
ENSBTAT00000006167 MI0003577 hsa-miR-570 CGAAAACAGCAAUUACCUUUGC
ENSBTAT00000006167 MI0003583 hsa-miR-576-5p AUUCUAAUUUCUCCACGUCUUU
ENSBTAT00000006167 MI0003641 hsa-miR-627 GUGAGUCUCUAAGAAAAGAGGA
ENSBTAT00000006167 MI0000097 hsa-miR-95 UUCAACGGGUAUUUAUUGAGCA
ENSBTAT00000006167 MI0000630 mmu-miR-344 UGAUCUAGCCAAAGCCUGACUGU
ENSBTAT00000006167 MI0005495 mmu-miR-344 UGAUCUAGCCAAAGCCUGACUGU
ENSBTAT00000006167 MI0002398 mmu-miR-463 UGAUAGACACCAUAUAAGGUAG
ENSBTAT00000006167 MI0004662 mmu-miR-693-3p GCAGCUUUCAGAUGUGGCUGUAA
ENSBTAT00000006167 MI0004694 mmu-miR-710 CCAAGUCUUGGGGAGAGUUGAG
ENSBTAT00000006167 MI0005476 mmu-miR-883a-3p UAACUGCAACAGCUCUCAGUAU
ENSBTAT00000006167 MI0005477 mmu-miR-883b-3p UAACUGCAACAUCUCUCAGUAU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Tortorella MD, et al. (2004) "Alpha2-macroglobulin is a novel substrate for ADAMTS-4 and ADAMTS-5 and represents an endogenous inhibitor of these enzymes." J Biol Chem. 279(17):17554-17561. PMID:14715656
  2. [ + ] Ireland JL, et al. (2004) "Evidence for autocrine or paracrine roles of alpha2-macroglobulin in regulation of estradiol production by granulosa cells and development of dominant follicles." Endocrinology. 145(6):2784-2794. PMID:15001551
  3. [ + ] Shibata M, et al. (2003) "Disruption of structural and functional integrity of alpha 2-macroglobulin by cathepsin E." Eur J Biochem. 270(6):1189-1198. PMID:12631277
  4. [ + ] Jenner L, et al. (1998) "Crystal structure of the receptor-binding domain of alpha 2-macroglobulin." Structure. 6(5):595-604. PMID:9634697
  5. [ + ] Barendse W, et al. (1992) "Linkage relations between A2M, HOX3, INT1, KRAS2, and PAH on bovine chromosome 5." Genomics. 14(1):38-42. PMID:1385300