ABHD13 | GeneID:513848 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 513848 Official Symbol ABHD13
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description abhydrolase domain containing 13
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 6716

ID Symbol Protein Species
GeneID:44441 Bem46 NP_477372.1 Drosophila melanogaster
GeneID:68904 Abhd13 NP_001074588.1 Mus musculus
GeneID:84945 ABHD13 NP_116248.2 Homo sapiens
GeneID:306630 Abhd13 XP_225044.3 Rattus norvegicus
GeneID:418763 ABHD13 NP_001008681.1 Gallus gallus
GeneID:467322 ABHD13 XP_001135541.1 Pan troglodytes
GeneID:513848 ABHD13 XP_878914.1 Bos taurus
GeneID:561333 zgc:123286 NP_001032774.1 Danio rerio
GeneID:832174 WAV2 NP_568395.1 Arabidopsis thaliana
GeneID:855396 YNL320W NP_014079.1 Saccharomyces cerevisiae
GeneID:1275600 AgaP_AGAP008746 XP_314863.2 Anopheles gambiae
GeneID:2540264 bem46 NP_595609.1 Schizosaccharomyces pombe
GeneID:2675206 MGG_00142 XP_369102.2 Magnaporthe grisea
GeneID:2712588 NCU03276.1 XP_330712.1 Neurospora crassa
GeneID:2894644 KLLA0E21065g XP_454899.1 Kluyveromyces lactis
GeneID:4343867 Os07g0608300 NP_001060241.1 Oryza sativa
GeneID:4620051 AGOS_ADL187W NP_983909.1 Eremothecium gossypii

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001101089 NP_001094559

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000003149 MI0005005 bta-miR-106 AAAAGUGCUUACAGUGCAGGUA
ENSBTAT00000003149 MI0004737 bta-miR-148a UCAGUGCACUACAGAACUUUGU
ENSBTAT00000003149 MI0005030 bta-miR-148b UCAGUGCAUCACAGAACUUUGU
ENSBTAT00000003149 MI0005059 bta-miR-342 UCUCACACAGAAAUCGCACCCAUCU
ENSBTAT00000003149 MI0005020 bta-miR-369-3p AAUAAUACAUGGUUGAUCUUU
ENSBTAT00000003149 MI0000748 hsa-miR-130b CAGUGCAAUGAUGAAAGGGCAU
ENSBTAT00000003149 MI0000462 hsa-miR-152 UCAGUGCAUGACAGAACUUGG
ENSBTAT00000003149 MI0000490 hsa-miR-206 UGGAAUGUAAGGAAGUGUGUGG
ENSBTAT00000003149 MI0000296 hsa-miR-219-5p UGAUUGUCCAAACGCAAUUCU
ENSBTAT00000003149 MI0000740 hsa-miR-219-5p UGAUUGUCCAAACGCAAUUCU
ENSBTAT00000003149 MI0005529 hsa-miR-220b CCACCACCGUGUCUGACACUU
ENSBTAT00000003149 MI0000091 hsa-miR-33a GUGCAUUGUAGUUGCAUUGCA
ENSBTAT00000003149 MI0003646 hsa-miR-33b GUGCAUUGCUGUUGCAUUGC
ENSBTAT00000003149 MI0002465 hsa-miR-410 AAUAUAACACAGAUGGCCUGU
ENSBTAT00000003149 MI0001733 hsa-miR-452 AACUGUUUGCAGAGGAAACUGA
ENSBTAT00000003149 MI0003194 hsa-miR-507 UUUUGCACCUUUUGGAGUGAA
ENSBTAT00000003149 MI0003195 hsa-miR-508-3p UGAUUGUAGCCUUUUGGAGUAGA
ENSBTAT00000003149 MI0003161 hsa-miR-517a AUCGUGCAUCCCUUUAGAGUGU
ENSBTAT00000003149 MI0003165 hsa-miR-517b UCGUGCAUCCCUUUAGAGUGUU
ENSBTAT00000003149 MI0003174 hsa-miR-517c AUCGUGCAUCCUUUUAGAGUGU
ENSBTAT00000003149 MI0003153 hsa-miR-523 GAACGCGCUUCCCUAUAGAGGGU
ENSBTAT00000003149 MI0003567 hsa-miR-561 CAAAGUUUAAGAUCCUUGAAGU
ENSBTAT00000003149 MI0003583 hsa-miR-576-3p AAGAUGUGGAAAAAUUGGAAUC
ENSBTAT00000003149 MI0003594 hsa-miR-586 UAUGCAUUGUAUUUUUAGGUCC
ENSBTAT00000003149 MI0003609 hsa-miR-597 UGUGUCACUCGAUGACCACUGU
ENSBTAT00000003149 MI0003643 hsa-miR-629 UGGGUUUACGUUGGGAGAACU
ENSBTAT00000003149 MI0003650 hsa-miR-635 ACUUGGGCACUGAAACAAUGUCC
ENSBTAT00000003149 MI0003761 hsa-miR-668 UGUCACUCGGCUCGGCCCACUAC
ENSBTAT00000003149 MI0005510 mmu-miR-466g AUACAGACACAUGCACACACA
ENSBTAT00000003149 MI0005512 mmu-miR-467c UAAGUGCGUGCAUGUAUAUGUG
ENSBTAT00000003149 MI0005513 mmu-miR-467d UAAGUGCGCGCAUGUAUAUGCG
ENSBTAT00000003149 MI0006128 mmu-miR-467e AUAAGUGUGAGCAUGUAUAUGU
ENSBTAT00000003149 MI0004662 mmu-miR-693-5p CAGCCACAUCCGAAAGUUUUC
ENSBTAT00000003149 MI0004698 mmu-miR-713 UGCACUGAAGGCACACAGC
ENSBTAT00000003149 MI0004708 mmu-miR-721 CAGUGCAAUUAAAAGGGGGAA
ENSBTAT00000003149 MI0005548 mmu-miR-878-3p GCAUGACACCACACUGGGUAGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene