ABCF2 | GeneID:513061 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 513061 Official Symbol ABCF2
Locus N/A Gene Type protein-coding
Synonyms MGC128735
Full Name N/A
Description ATP-binding cassette, sub-family F (GCN20), member 2
Chromosome N/A
Also Known As ATP-binding cassette, sub-family F, member 2
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 21408

ID Symbol Protein Species
GeneID:10061 ABCF2 NP_005683.2 Homo sapiens
GeneID:27407 Abcf2 NP_038881.1 Mus musculus
GeneID:32508 CG9281 NP_573057.1 Drosophila melanogaster
GeneID:176771 abcf-2 NP_499779.1 Caenorhabditis elegans
GeneID:311959 Abcf2 XP_231307.1 Rattus norvegicus
GeneID:336770 abcf2 NP_958472.1 Danio rerio
GeneID:426038 ABCF2 NP_001006562.1 Gallus gallus
GeneID:463887 ABCF2 XP_001139777.1 Pan troglodytes
GeneID:482806 ABCF2 XP_850220.1 Canis lupus familiaris
GeneID:513061 ABCF2 NP_001039601.1 Bos taurus
GeneID:836200 ATGCN1 NP_200887.1 Arabidopsis thaliana
GeneID:1273267 AgaP_AGAP002693 XP_312228.2 Anopheles gambiae
GeneID:4346343 Os08g0564100 NP_001062528.1 Oryza sativa
GeneID:4347924 Os09g0572400 NP_001063997.1 Oryza sativa
GeneID:100000576 LOC100000576 XP_001337123.1 Danio rerio

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001046136 NP_001039601

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000000799 MI0005027 bta-miR-124a UUAAGGCACGCGGUGAAUGCCAA
ENSBTAT00000000799 MI0004754 bta-miR-126 CGUACCGUGAGUAAUAAUGCG
ENSBTAT00000000799 MI0004738 bta-miR-151* UCGAGGAGCUCACAGUCUAGU
ENSBTAT00000000799 MI0004999 gga-miR-757 GCAGAGCUGCAGAUGGGAUUC
ENSBTAT00000000799 MI0005000 gga-miR-757 GCAGAGCUGCAGAUGGGAUUC
ENSBTAT00000000799 MI0000240 hsa-miR-198 GGUCCAGAGGGGAGAUAGGUUC
ENSBTAT00000000799 MI0000791 hsa-miR-383 AGAUCAGAAGGUGAUUGUGGCU
ENSBTAT00000000799 MI0003570 hsa-miR-564 AGGCACGGUGUCAGCAGGC
ENSBTAT00000000799 MI0003615 hsa-miR-602 GACACGGGCGACAGCUGCGGCCC
ENSBTAT00000000799 MI0003622 hsa-miR-609 AGGGUGUUUCUCUCAUCUCU
ENSBTAT00000000799 MI0003662 hsa-miR-647 GUGGCUGCACUCACUUCCUUC
ENSBTAT00000000799 MI0005527 hsa-miR-886-5p CGGGUCGGAGUUAGCUCAAGCGG
ENSBTAT00000000799 MI0005712 hsa-miR-920 GGGGAGCUGUGGAAGCAGUA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Harhay GP, et al. (2005) "Characterization of 954 bovine full-CDS cDNA sequences." BMC Genomics. 6():166. PMID:16305752
  2. [ + ] Smith TP, et al. (2001) "Sequence evaluation of four pooled-tissue normalized bovine cDNA libraries and construction of a gene index for cattle." Genome Res. 11(4):626-630. PMID:11282978