ABCC5 | GeneID:511769 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 511769 Official Symbol ABCC5
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family C (CFTR/MRP), member 5
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 21164

ID Symbol Protein Species
GeneID:10057 ABCC5 NP_005679.2 Homo sapiens
GeneID:27416 Abcc5 NP_038818.2 Mus musculus
GeneID:116721 Abcc5 NP_446376.1 Rattus norvegicus
GeneID:181587 mrp-5 NP_510479.1 Caenorhabditis elegans
GeneID:424947 ABCC5 XP_422754.2 Gallus gallus
GeneID:478648 ABCC5 XP_857354.1 Canis lupus familiaris
GeneID:511769 ABCC5 XP_001251891.1 Bos taurus
GeneID:796249 LOC796249 XP_001333981.2 Danio rerio
GeneID:4329047 Os02g0288400 NP_001046583.1 Oryza sativa
GeneID:4329049 Os02g0288700 NP_001046585.1 Oryza sativa

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005524 Function ATP binding

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001077907 NP_001071375

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000032142 MI0003641 hsa-miR-627 GUGAGUCUCUAAGAAAAGAGGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene