ABCA7 | GeneID:511762 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 511762 Official Symbol ABCA7
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family A (ABC1), member 7
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 22783

ID Symbol Protein Species
GeneID:10347 ABCA7 NP_061985.2 Homo sapiens
GeneID:27403 Abca7 NP_038878.1 Mus musculus
GeneID:299609 Abca7 NP_997481.1 Rattus norvegicus
GeneID:455538 ABCA7 XP_512226.2 Pan troglodytes
GeneID:485090 ABCA7 XP_542208.2 Canis lupus familiaris
GeneID:511762 ABCA7 XP_589159.3 Bos taurus

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_589159 XP_589159

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000020083 MI0005462 bta-miR-204 UUCCCUUUGUCAUCCUAUGCCU
ENSBTAT00000020083 MI0000450 hsa-miR-133a UUUGGUCCCCUUCAACCAGCUG
ENSBTAT00000020083 MI0000451 hsa-miR-133a UUUGGUCCCCUUCAACCAGCUG
ENSBTAT00000020083 MI0000822 hsa-miR-133b UUUGGUCCCCUUCAACCAGCUA
ENSBTAT00000020083 MI0000287 hsa-miR-211 UUCCCUUUGUCAUCCUUCGCCU
ENSBTAT00000020083 MI0000808 hsa-miR-326 CCUCUGGGCCCUUCCUCCAG
ENSBTAT00000020083 MI0003180 hsa-miR-516a-3p UGCUUCCUUUCAGAGGGU
ENSBTAT00000020083 MI0003181 hsa-miR-516a-3p UGCUUCCUUUCAGAGGGU
ENSBTAT00000020083 MI0003603 hsa-miR-591 AGACCAUGGGUUCUCAUUGU
ENSBTAT00000020083 MI0003836 hsa-miR-766 ACUCCAGCCCCACAGCCUCAGC
ENSBTAT00000020083 MI0005532 hsa-miR-874 CUGCCCUGGCCCGAGGGACCGA
ENSBTAT00000020083 MI0000466 hsa-miR-9 UCUUUGGUUAUCUAGCUGUAUGA
ENSBTAT00000020083 MI0000467 hsa-miR-9 UCUUUGGUUAUCUAGCUGUAUGA
ENSBTAT00000020083 MI0000468 hsa-miR-9 UCUUUGGUUAUCUAGCUGUAUGA
ENSBTAT00000020083 MI0000635 rno-miR-347 UGUCCCUCUGGGUCGCCCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_589159  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene