AADAT | GeneID:51166 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 51166 Official Symbol AADAT
Locus N/A Gene Type protein-coding
Synonyms KAT2; KATII
Full Name aminoadipate aminotransferase
Description aminoadipate aminotransferase
Chromosome 4q33
Also Known As L kynurenine/alpha aminoadipate aminotransferase; kynurenine aminotransferase II
Summary This gene encodes a protein that is highly similar to mouse and rat kynurenine aminotransferase II. The rat protein is a homodimer with two transaminase activities. One activity is the transamination of alpha-aminoadipic acid, a final step in the saccaropine pathway which is the major pathway for L-lysine catabolism. The other activity involves the transamination of kynurenine to produce kynurenine acid, the precursor of kynurenic acid which has neuroprotective properties. Two alternative transcripts encoding the same isoform have been identified, however, additional alternative transcripts and isoforms may exist. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 56540

ID Symbol Protein Species
GeneID:23923 Aadat NP_035964.1 Mus musculus
GeneID:29416 Aadat NP_058889.1 Rattus norvegicus
GeneID:51166 AADAT NP_057312.1 Homo sapiens
GeneID:428728 AADAT XP_426286.2 Gallus gallus
GeneID:461601 AADAT XP_001154960.1 Pan troglodytes
GeneID:486059 AADAT XP_543185.2 Canis lupus familiaris
GeneID:508929 AADAT NP_001015551.1 Bos taurus
GeneID:520638 LOC520638 XP_598886.3 Bos taurus
GeneID:557979 LOC557979 XP_686234.3 Danio rerio
GeneID:5048716 MGG_14221 XP_001402824.1 Magnaporthe grisea

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab59132 Aminoadipate aminotransferase antibody (ab59132); Rabbit polyclonal to Aminoadipate aminotransferase
2 acris AP07114PU-N AADAT; antibody Ab
3 acris AP07115PU-N AADAT; antibody Ab
4 acris AP16968PU-N AADAT; antibody Ab
5 scbt AADAT AADAT Antibody / AADAT Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of AADAT Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of AADAT Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005829 Component cytosol
GO:0005739 Component mitochondrion
GO:0047536 Function 2-aminoadipate transaminase activity
GO:0016212 Function kynurenine-oxoglutarate transaminase activity
GO:0030170 Function pyridoxal phosphate binding
GO:0009058 Process biosynthetic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_016228  UCSC Browser NP_057312 Q4W5N8   Q8N5Z0  
2 NM_182662  UCSC Browser NP_872603 Q4W5N8   Q8N5Z0  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000337664 MI0000113 hsa-miR-106a AAAAGUGCUUACAGUGCAGGUAG
ENST00000337664 MI0000734 hsa-miR-106b UAAAGUGCUGACAGUGCAGAU
ENST00000337664 MI0000252 hsa-miR-129-5p CUUUUUGCGGUCUGGGCUUGC
ENST00000337664 MI0000473 hsa-miR-129-5p CUUUUUGCGGUCUGGGCUUGC
ENST00000337664 MI0000069 hsa-miR-15a UAGCAGCACAUAAUGGUUUGUG
ENST00000337664 MI0000071 hsa-miR-17 CAAAGUGCUUACAGUGCAGGUAG
ENST00000337664 MI0000242 hsa-miR-199a-5p CCCAGUGUUCAGACUACCUGUUC
ENST00000337664 MI0000281 hsa-miR-199a-5p CCCAGUGUUCAGACUACCUGUUC
ENST00000337664 MI0000282 hsa-miR-199b-5p CCCAGUGUUUAGACUAUCUGUUC
ENST00000337664 MI0000076 hsa-miR-20a UAAAGUGCUUAUAGUGCAGGUAG
ENST00000337664 MI0001519 hsa-miR-20b CAAAGUGCUCAUAGUGCAGGUAG
ENST00000337664 MI0000078 hsa-miR-22* AGUUCUUCAGUGGCAAGCUUUA
ENST00000337664 MI0000301 hsa-miR-224 CAAGUCACUAGUGGUUCCGUU
ENST00000337664 MI0000802 hsa-miR-340 UUAUAAAGCAAUGAGACUGAUU
ENST00000337664 MI0000781 hsa-miR-373 GAAGUGCUUCGAUUUUGGGGUGU
ENST00000337664 MI0000782 hsa-miR-374a UUAUAAUACAACCUGAUAAGUG
ENST00000337664 MI0000790 hsa-miR-382 GAAGUUGUUCGUGGUGGAUUCG
ENST00000337664 MI0001723 hsa-miR-433 AUCAUGAUGGGCUCCUCGGUGU
ENST00000337664 MI0001652 hsa-miR-450a UUUUGCGAUGUGUUCCUAAUAU
ENST00000337664 MI0003187 hsa-miR-450a UUUUGCGAUGUGUUCCUAAUAU
ENST00000337664 MI0005531 hsa-miR-450b-5p UUUUGCAAUAUGUUCCUGAAUA
ENST00000337664 MI0003195 hsa-miR-508-3p UGAUUGUAGCCUUUUGGAGUAGA
ENST00000337664 MI0005717 hsa-miR-509-3-5p UACUGCAGACGUGGCAAUCAUG
ENST00000337664 MI0003196 hsa-miR-509-5p UACUGCAGACAGUGGCAAUCA
ENST00000337664 MI0005530 hsa-miR-509-5p UACUGCAGACAGUGGCAAUCA
ENST00000337664 MI0003140 hsa-miR-512-3p AAGUGCUGUCAUAGCUGAGGUC
ENST00000337664 MI0003141 hsa-miR-512-3p AAGUGCUGUCAUAGCUGAGGUC
ENST00000337664 MI0003166 hsa-miR-520g ACAAAGUGCUUCCCUUUAGAGUGU
ENST00000337664 MI0003177 hsa-miR-522 AAAAUGGUUCCCUUUAGAGUGU
ENST00000337664 MI0003612 hsa-miR-548a-5p AAAAGUAAUUGCGAGUUUUACC
ENST00000337664 MI0003567 hsa-miR-561 CAAAGUUUAAGAUCCUUGAAGU
ENST00000337664 MI0003619 hsa-miR-606 AAACUACUGAAAAUCAAAGAU
ENST00000337664 MI0003629 hsa-miR-616* ACUCAAAACCCUUCAGUGACUU
ENST00000337664 MI0003666 hsa-miR-651 UUUAGGAUAAGCUUGACUUUUG
ENST00000337664 MI0000095 hsa-miR-93 CAAAGUGCUGUUCGUGCAGGUAG
ENST00000337664 MI0000389 mmu-miR-291a-3p AAAGUGCUUCCACUUUGUGUGC
ENST00000337664 MI0000392 mmu-miR-294 AAAGUGCUUCCCUUUUGUGUGU
ENST00000337664 MI0004554 mmu-miR-759 GCAGAGUGCAAACAAUUUUGAC
ENST00000337664 MI0005548 mmu-miR-878-5p UAUCUAGUUGGAUGUCAAGACA
ENST00000337664 MI0005476 mmu-miR-883a-3p UAACUGCAACAGCUCUCAGUAU
ENST00000337664 MI0005477 mmu-miR-883b-3p UAACUGCAACAUCUCUCAGUAU
ENST00000353187 MI0000242 hsa-miR-199a-5p CCCAGUGUUCAGACUACCUGUUC
ENST00000353187 MI0000281 hsa-miR-199a-5p CCCAGUGUUCAGACUACCUGUUC
ENST00000353187 MI0000282 hsa-miR-199b-5p CCCAGUGUUUAGACUAUCUGUUC
ENST00000353187 MI0000078 hsa-miR-22* AGUUCUUCAGUGGCAAGCUUUA
ENST00000353187 MI0000301 hsa-miR-224 CAAGUCACUAGUGGUUCCGUU
ENST00000353187 MI0000781 hsa-miR-373 GAAGUGCUUCGAUUUUGGGGUGU
ENST00000353187 MI0000790 hsa-miR-382 GAAGUUGUUCGUGGUGGAUUCG
ENST00000353187 MI0001652 hsa-miR-450a UUUUGCGAUGUGUUCCUAAUAU
ENST00000353187 MI0003187 hsa-miR-450a UUUUGCGAUGUGUUCCUAAUAU
ENST00000353187 MI0005531 hsa-miR-450b-5p UUUUGCAAUAUGUUCCUGAAUA
ENST00000353187 MI0003195 hsa-miR-508-3p UGAUUGUAGCCUUUUGGAGUAGA
ENST00000353187 MI0005717 hsa-miR-509-3-5p UACUGCAGACGUGGCAAUCAUG
ENST00000353187 MI0003196 hsa-miR-509-5p UACUGCAGACAGUGGCAAUCA
ENST00000353187 MI0005530 hsa-miR-509-5p UACUGCAGACAGUGGCAAUCA
ENST00000353187 MI0003166 hsa-miR-520g ACAAAGUGCUUCCCUUUAGAGUGU
ENST00000353187 MI0003177 hsa-miR-522 AAAAUGGUUCCCUUUAGAGUGU
ENST00000353187 MI0003619 hsa-miR-606 AAACUACUGAAAAUCAAAGAU
ENST00000353187 MI0003629 hsa-miR-616* ACUCAAAACCCUUCAGUGACUU
ENST00000353187 MI0000392 mmu-miR-294 AAAGUGCUUCCCUUUUGUGUGU
ENST00000353187 MI0004554 mmu-miR-759 GCAGAGUGCAAACAAUUUUGAC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Acetaminophen
  • Acetaminophen affects the expression of AADAT mRNA
17562736
Phthalic Acids
  • Phthalic Acids results in decreased expression of AADAT mRNA
15728792
Tetrachlorodibenzodioxin
  • Tetrachlorodibenzodioxin results in increased expression of AADAT mRNA
16054898
Uranium
  • Uranium affects the expression of AADAT mRNA
15672453
uranyl acetate
  • uranyl acetate affects the expression of AADAT mRNA
15672453

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Adenoma, Liver Cell inferred via Tetrachlorodibenzodioxin 16835633
Carcinoma inferred via Tetrachlorodibenzodioxin 16835633
Cholangiocarcinoma inferred via Tetrachlorodibenzodioxin 16835633
Cleft Palate inferred via Tetrachlorodibenzodioxin 8697196
Diabetes Mellitus, Type 2 inferred via Tetrachlorodibenzodioxin 17107852
Hydronephrosis inferred via Tetrachlorodibenzodioxin 8697196
Liver Neoplasms inferred via Tetrachlorodibenzodioxin 16984957
Hepatitis, Toxic inferred via Acetaminophen 2444490, 17562736, 16177239, 15968718, 16227642, 14986274, 17522070, 16081117
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Han Q, et al. (2008) "Crystal structure of human kynurenine aminotransferase II." J Biol Chem. 283(6):3567-3573. PMID:18056995
  2. [ + ] Rossi F, et al. (2008) "Crystal structure of human kynurenine aminotransferase II, a drug target for the treatment of schizophrenia." J Biol Chem. 283(6):3559-3566. PMID:18056996
  3. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  4. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  5. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  6. [ + ] Goh DL, et al. (2002) "Characterization of the human gene encoding alpha-aminoadipate aminotransferase (AADAT)." Mol Genet Metab. 76(3):172-180. PMID:12126930
  7. [ + ] Yu P, et al. (1999) "Genomic organization and expression analysis of mouse kynurenine aminotransferase II, a possible factor in the pathophysiology of Huntington's disease." Mamm Genome. 10(9):845-852. PMID:10441733
  8. [ + ] Okuno E, et al. (1993) "2-Aminoadipate-2-oxoglutarate aminotransferase isoenzymes in human liver: a plausible physiological role in lysine and tryptophan metabolism." Enzyme Protein. 47(3):136-148. PMID:8087205
  9. [ + ] Mawal MR, et al. (1991) "Purification and properties of alpha-aminoadipate aminotransferase from rat liver and kidney mitochondria." Prep Biochem. 21(2-3):151-162. PMID:1798692