AATK | GeneID:511515 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 511515 Official Symbol AATK
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description apoptosis-associated tyrosine kinase
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 74861

ID Symbol Protein Species
GeneID:9625 AATK NP_001073864.1 Homo sapiens
GeneID:11302 Aatk NP_031403.2 Mus musculus
GeneID:511515 AATK XP_588863.3 Bos taurus
GeneID:555739 LOC555739 XP_683424.3 Danio rerio
GeneID:690853 Aatk XP_001075880.1 Rattus norvegicus
GeneID:100004850 LOC100004850 XP_001344052.2 Danio rerio
GeneID:100149793 LOC100149793 XP_001920174.1 Danio rerio

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005524 Function ATP binding
GO:0004713 Function protein tyrosine kinase activity
GO:0006468 Process protein amino acid phosphorylation

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_588863 XP_588863

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000025356 MI0004754 bta-miR-126 CGUACCGUGAGUAAUAAUGCG
ENSBTAT00000025356 MI0004737 bta-miR-148a UCAGUGCACUACAGAACUUUGU
ENSBTAT00000025356 MI0005030 bta-miR-148b UCAGUGCAUCACAGAACUUUGU
ENSBTAT00000025356 MI0005458 bta-miR-15a UAGCAGCACAUAAUGGUUUGU
ENSBTAT00000025356 MI0005012 bta-miR-15b UAGCAGCACAUCAUGGUUUACA
ENSBTAT00000025356 MI0004742 bta-miR-21* AACAGCAGUCGAUGGGCUGUCU
ENSBTAT00000025356 MI0005040 bta-miR-214 ACAGCAGGCACAGACAGGCAGU
ENSBTAT00000025356 MI0005467 bta-miR-497 CAGCAGCACACUGUGGUUUGUA
ENSBTAT00000025356 MI0000462 hsa-miR-152 UCAGUGCAUGACAGAACUUGG
ENSBTAT00000025356 MI0000239 hsa-miR-197 UUCACCACCUUCUCCACCCAGC
ENSBTAT00000025356 MI0000813 hsa-miR-324-5p CGCAUCCCCUAGGGCAUUGGUGU
ENSBTAT00000025356 MI0000826 hsa-miR-346 UGUCUGCCCGCAUGCCUGCCUCU
ENSBTAT00000025356 MI0001735 hsa-miR-409-5p AGGUUACCCGAGCAACUUUGCAU
ENSBTAT00000025356 MI0003133 hsa-miR-432 UCUUGGAGUAGGUCAUUGGGUGG
ENSBTAT00000025356 MI0003188 hsa-miR-503 UAGCAGCGGGAACAGUUCUGCAG
ENSBTAT00000025356 MI0003170 hsa-miR-518a-3p GAAAGCGCUUCCCUUUGCUGGA
ENSBTAT00000025356 MI0003173 hsa-miR-518a-3p GAAAGCGCUUCCCUUUGCUGGA
ENSBTAT00000025356 MI0003156 hsa-miR-518b CAAAGCGCUCCCCUUUAGAGGU
ENSBTAT00000025356 MI0003159 hsa-miR-518c CAAAGCGCUUCUCUUUAGAGUGU
ENSBTAT00000025356 MI0003171 hsa-miR-518d-3p CAAAGCGCUUCCCUUUGGAGC
ENSBTAT00000025356 MI0003563 hsa-miR-557 GUUUGCACGGGUGGGCCUUGUCU
ENSBTAT00000025356 MI0003608 hsa-miR-596 AAGCCUGCCCGGCUCCUCGGG
ENSBTAT00000025356 MI0003635 hsa-miR-621 GGCUAGCAACAGCGCUUACCU
ENSBTAT00000025356 MI0003651 hsa-miR-636 UGUGCUUGCUCGUCCCGCCCGCA
ENSBTAT00000025356 MI0003654 hsa-miR-639 AUCGCUGCGGUUGCGAGCGCUGU
ENSBTAT00000025356 MI0003682 hsa-miR-658 GGCGGAGGGAAGUAGGUCCGUUGGU
ENSBTAT00000025356 MI0003763 hsa-miR-767-5p UGCACCAUGGUUGUCUGAGCAUG
ENSBTAT00000025356 MI0005533 hsa-miR-890 UACUUGGAAAGGCAUCAGUUG
ENSBTAT00000025356 MI0000244 mmu-miR-201 UACUCAGUAAGGCAUUGUUCUU
ENSBTAT00000025356 MI0000590 mmu-miR-322 CAGCAGCAAUUCAUGUUUUGGA
ENSBTAT00000025356 MI0004553 mmu-miR-666-5p AGCGGGCACAGCUGUGAGAGCC
ENSBTAT00000025356 MI0005003 mmu-miR-676 CCGUCCUGAGGUUGUUGAGCU
ENSBTAT00000025356 MI0004682 mmu-miR-698 CAUUCUCGUUUCCUUCCCU
ENSBTAT00000025356 MI0004698 mmu-miR-713 UGCACUGAAGGCACACAGC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_588863  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene