A4GNT | GeneID:51146 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 51146 Official Symbol A4GNT
Locus N/A Gene Type protein-coding
Synonyms MGC149493; alpha4GnT
Full Name alpha-1,4-N-acetylglucosaminyltransferase
Description alpha-1,4-N-acetylglucosaminyltransferase
Chromosome 3p14.3
Also Known As
Summary This gene encodes a protein from the glycosyltransferase 32 family. The enzyme catalyzes the transfer of N-acetylglucosamine (GlcNAc) to core 2 branched O-glycans. It forms a unique glycan, GlcNAcalpha1-->4Galbeta-->R and is largely associated with the Golgi apparatus membrane. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 87446

ID Symbol Protein Species
GeneID:51146 A4GNT NP_057245.1 Homo sapiens
GeneID:333424 A4gnt NP_001070892.1 Mus musculus
GeneID:429136 A4GNT XP_426692.2 Gallus gallus
GeneID:460724 A4GNT XP_516775.2 Pan troglodytes
GeneID:485683 A4GNT XP_542803.2 Canis lupus familiaris
GeneID:540795 A4GNT XP_613170.1 Bos taurus
GeneID:685758 A4gnt XP_001065156.1 Rattus norvegicus

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 sigma HPA008017 Anti-A4GNT antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of A4GNT Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of A4GNT Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0005794 Component Golgi apparatus
GO:0000139 Component Golgi membrane
GO:0005795 Component Golgi stack
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0005624 Component membrane fraction
GO:0005730 Component nucleolus
GO:0005634 Component nucleus
GO:0008375 Function acetylglucosaminyltransferase activity
GO:0008378 Function galactosyltransferase activity
GO:0016757 Function transferase activity, transferring glycosyl groups
GO:0005975 Process carbohydrate metabolic process
GO:0009101 Process glycoprotein biosynthetic process
GO:0006493 Process protein amino acid O-linked glycosylation

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_016161  UCSC Browser NP_057245

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000236709 MI0000113 hsa-miR-106a* CUGCAAUGUAAGCACUUCUUAC
ENST00000236709 MI0000448 hsa-miR-130a CAGUGCAAUGUUAAAAGGGCAU
ENST00000236709 MI0000748 hsa-miR-130b CAGUGCAAUGAUGAAAGGGCAU
ENST00000236709 MI0000462 hsa-miR-152 UCAGUGCAUGACAGAACUUGG
ENST00000236709 MI0000069 hsa-miR-15a UAGCAGCACAUAAUGGUUUGUG
ENST00000236709 MI0000438 hsa-miR-15b UAGCAGCACAUCAUGGUUUACA
ENST00000236709 MI0000070 hsa-miR-16 UAGCAGCACGUAAAUAUUGGCG
ENST00000236709 MI0000115 hsa-miR-16 UAGCAGCACGUAAAUAUUGGCG
ENST00000236709 MI0000489 hsa-miR-195 UAGCAGCACAGAAAUAUUGGC
ENST00000236709 MI0000342 hsa-miR-200b* CAUCUUACUGGGCAGCAUUGGA
ENST00000236709 MI0000078 hsa-miR-22 AAGCUGCCAGUUGAAGAACUGU
ENST00000236709 MI0000299 hsa-miR-222 AGCUACAUCUGGCUACUGGGU
ENST00000236709 MI0000081 hsa-miR-24-2* UGCCUACUGAGCUGAAACACAG
ENST00000236709 MI0001446 hsa-miR-424 CAGCAGCAAUUCAUGUUUUGAA
ENST00000236709 MI0003138 hsa-miR-497 CAGCAGCACACUGUGGUUUGU
ENST00000236709 MI0003195 hsa-miR-508-5p UACUCCAGAGGGCGUCACUCAUG
ENST00000236709 MI0005717 hsa-miR-509-3-5p UACUGCAGACGUGGCAAUCAUG
ENST00000236709 MI0003196 hsa-miR-509-5p UACUGCAGACAGUGGCAAUCA
ENST00000236709 MI0005530 hsa-miR-509-5p UACUGCAGACAGUGGCAAUCA
ENST00000236709 MI0003178 hsa-miR-519a AAAGUGCAUCCUUUUAGAGUGU
ENST00000236709 MI0003182 hsa-miR-519a AAAGUGCAUCCUUUUAGAGUGU
ENST00000236709 MI0003151 hsa-miR-519b-3p AAAGUGCAUCCUUUUAGAGGUU
ENST00000236709 MI0003148 hsa-miR-519c-3p AAAGUGCAUCUUUUUAGAGGAU
ENST00000236709 MI0003559 hsa-miR-554 GCUAGUCCUGACUCAGCCAGU
ENST00000236709 MI0003576 hsa-miR-569 AGUUAAUGAAUCCUGGAAAGU
ENST00000236709 MI0003603 hsa-miR-591 AGACCAUGGGUUCUCAUUGU
ENST00000236709 MI0003655 hsa-miR-640 AUGAUCCAGGAACCUGCCUCU
ENST00000236709 MI0005713 hsa-miR-921 CUAGUGAGGGACAGAACCAGGAUUC
ENST00000236709 MI0000098 hsa-miR-96 UUUGGCACUAGCACAUUUUUGCU
ENST00000236709 MI0003539 mmu-miR-291b-3p AAAGUGCAUCCAUUUUGUUUGU
ENST00000236709 MI0000590 mmu-miR-322 CAGCAGCAAUUCAUGUUUUGGA
ENST00000236709 MI0002404 mmu-miR-469 UGCCUCUUUCAUUGAUCUUGGUGUCC
ENST00000236709 MI0004659 mmu-miR-691 AUUCCUGAAGAGAGGCAGAAAA
ENST00000236709 MI0004704 mmu-miR-717 CUCAGACAGAGAUACCUUCUCU
ENST00000236709 MI0004708 mmu-miR-721 CAGUGCAAUUAAAAGGGGGAA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Barbe L, et al. (2008) "Toward a confocal subcellular atlas of the human proteome." Mol Cell Proteomics. 7(3):499-508. PMID:18029348
  2. [ + ] Ishizone S, et al. (2006) "Clinical utility of quantitative RT-PCR targeted to alpha1,4-N-acetylglucosaminyltransferase mRNA for detection of pancreatic cancer." Cancer Sci. 97(2):119-126. PMID:16441422
  3. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  4. [ + ] Shimizu F, et al. (2003) "Usefulness of the real-time reverse transcription-polymerase chain reaction assay targeted to alpha1,4-N-acetylglucosaminyltransferase for the detection of gastric cancer." Lab Invest. 83(2):187-197. PMID:12594234
  5. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  6. [ + ] Zhang MX, et al. (2001) "Immunohistochemical demonstration of alpha1,4-N-acetylglucosaminyltransferase that forms GlcNAcalpha1,4Galbeta residues in human gastrointestinal mucosa." J Histochem Cytochem. 49(5):587-596. PMID:11304796
  7. [ + ] Nakayama J, et al. (1999) "Expression cloning of a human alpha1, 4-N-acetylglucosaminyltransferase that forms GlcNAcalpha1-->4Galbeta-->R, a glycan specifically expressed in the gastric gland mucous cell-type mucin." Proc Natl Acad Sci U S A. 96(16):8991-8996. PMID:10430883
  8. [ + ] Suzuki Y, et al. (1997) "Construction and characterization of a full length-enriched and a 5'-end-enriched cDNA library." Gene. 200(1-2):149-156. PMID:9373149
  9. [ + ] Maruyama K, et al. (1994) "Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides." Gene. 138(1-2):171-174. PMID:8125298