ABHD5 | GeneID:51099 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 51099 Official Symbol ABHD5
Locus N/A Gene Type protein-coding
Synonyms CDS; CGI58; IECN2; MGC8731; NCIE2
Full Name abhydrolase domain containing 5
Description abhydrolase domain containing 5
Chromosome 3p21
Also Known As
Summary The protein encoded by this gene belongs to a large family of proteins defined by an alpha/beta hydrolase fold, and contains three sequence motifs that correspond to a catalytic triad found in the esterase/lipase/thioesterase subfamily. It differs from other members of this subfamily in that its putative catalytic triad contains an asparagine instead of the serine residue. Mutations in this gene have been associated with Chanarin-Dorfman syndrome, a triglyceride storage disease with impaired long-chain fatty acid oxidation. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 41088

ID Symbol Protein Species
GeneID:51099 ABHD5 NP_057090.2 Homo sapiens
GeneID:67469 Abhd5 NP_080455.1 Mus musculus
GeneID:316122 Abhd5 NP_997689.1 Rattus norvegicus
GeneID:460303 ABHD5 XP_516397.2 Pan troglodytes
GeneID:485570 ABHD5 XP_542689.2 Canis lupus familiaris
GeneID:535588 ABHD5 NP_001069531.1 Bos taurus
GeneID:566493 abhd5 XP_694855.2 Danio rerio

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab58283 Abhd5 antibody (ab58283); Mouse monoclonal to Abhd5
2 abcam ab54001 Abhd5 antibody (ab54001); Rabbit polyclonal to Abhd5
3 abcam ab59488 Abhd5 antibody (ab59488); Goat polyclonal to Abhd5
4 abcam ab58275 Abhd5 antibody (ab58275); Mouse monoclonal to Abhd5
5 abnova H00051099-M01 ABHD5 monoclonal antibody (M01), clone 1F3; Mouse monoclonal antibody raised against a full length recombinant ABHD5.
6 abnova H00051099-M02 ABHD5 monoclonal antibody (M02), clone 4B12; Mouse monoclonal antibody raised against a partial recombinant ABHD5.
7 acris AP16647PU-N ABHD5; antibody Ab
8 scbt ABHD5 ABHD5 Antibody / ABHD5 Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of ABHD5 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABHD5 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0012511 Component monolayer-surrounded lipid storage body
GO:0005515 Function protein binding
GO:0006629 Process lipid metabolic process
GO:0007605 Process sensory perception of sound

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_016006  UCSC Browser NP_057090 Q8WTS1   B2R9K0  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000013894 MI0004999 gga-miR-757 GCAGAGCUGCAGAUGGGAUUC
ENST00000013894 MI0005000 gga-miR-757 GCAGAGCUGCAGAUGGGAUUC
ENST00000013894 MI0000443 hsa-miR-124 UAAGGCACGCGGUGAAUGCC
ENST00000013894 MI0000444 hsa-miR-124 UAAGGCACGCGGUGAAUGCC
ENST00000013894 MI0000445 hsa-miR-124 UAAGGCACGCGGUGAAUGCC
ENST00000013894 MI0000473 hsa-miR-129-3p AAGCCCUUACCCCAAAAAGCAU
ENST00000013894 MI0000452 hsa-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
ENST00000013894 MI0000453 hsa-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
ENST00000013894 MI0000810 hsa-miR-135b* AUGUAGGGCUAAAAGCCAUGGG
ENST00000013894 MI0000454 hsa-miR-137 UUAUUGCUUAAGAAUACGCGUAG
ENST00000013894 MI0000455 hsa-miR-138-2* GCUAUUUCACGACACCAGGGUU
ENST00000013894 MI0000461 hsa-miR-145* GGAUUCCUGGAAAUACUGUUCU
ENST00000013894 MI0000262 hsa-miR-147 GUGUGUGGAAAUGCUUCUGC
ENST00000013894 MI0000273 hsa-miR-183* GUGAAUUACCGAAGGGCCAUAA
ENST00000013894 MI0000482 hsa-miR-185 UGGAGAGAAAGGCAGUUCCUGA
ENST00000013894 MI0000073 hsa-miR-19a UGUGCAAAUCUAUGCAAAACUGA
ENST00000013894 MI0000074 hsa-miR-19b UGUGCAAAUCCAUGCAAAACUGA
ENST00000013894 MI0000075 hsa-miR-19b UGUGCAAAUCCAUGCAAAACUGA
ENST00000013894 MI0003130 hsa-miR-202 AGAGGUAUAGGGCAUGGGAA
ENST00000013894 MI0000740 hsa-miR-219-2-3p AGAAUUGUGGCUGGACAUCUGU
ENST00000013894 MI0000078 hsa-miR-22* AGUUCUUCAGUGGCAAGCUUUA
ENST00000013894 MI0000301 hsa-miR-224 CAAGUCACUAGUGGUUCCGUU
ENST00000013894 MI0000083 hsa-miR-26a-1* CCUAUUCUUGGUUACUUGCACG
ENST00000013894 MI0000750 hsa-miR-26a-2* CCUAUUCUUGAUUACUUGUUUC
ENST00000013894 MI0000105 hsa-miR-29b-1* GCUGGUUUCAUAUGGUGGUUUAGA
ENST00000013894 MI0000745 hsa-miR-301a CAGUGCAAUAGUAUUGUCAAAGC
ENST00000013894 MI0005568 hsa-miR-301b CAGUGCAAUGAUAUUGUCAAAGC
ENST00000013894 MI0000816 hsa-miR-335* UUUUUCAUUAUUGCUCCUGACC
ENST00000013894 MI0000806 hsa-miR-337-5p GAACGGCUUCAUACAGGAGUU
ENST00000013894 MI0002466 hsa-miR-376b AUCAUAGAGGAAAAUCCAUGUU
ENST00000013894 MI0001145 hsa-miR-384 AUUCCUAGAAAUUGUUCAUA
ENST00000013894 MI0001445 hsa-miR-423-5p UGAGGGGCAGAGAGCGAGACUUU
ENST00000013894 MI0003193 hsa-miR-506 UAAGGCACCCUUCUGAGUAGA
ENST00000013894 MI0003196 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENST00000013894 MI0005530 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENST00000013894 MI0005717 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENST00000013894 MI0003170 hsa-miR-518a-5p CUGCAAAGGGAAGCCCUUUC
ENST00000013894 MI0003173 hsa-miR-518a-5p CUGCAAAGGGAAGCCCUUUC
ENST00000013894 MI0003171 hsa-miR-518d-5p CUCUAGAGGGAAGCACUUUCUG
ENST00000013894 MI0003169 hsa-miR-518e* CUCUAGAGGGAAGCGCUUUCUG
ENST00000013894 MI0003154 hsa-miR-518f* CUCUAGAGGGAAGCACUUUCUC
ENST00000013894 MI0003163 hsa-miR-521 AACGCACUUCCCUUUAGAGUGU
ENST00000013894 MI0003176 hsa-miR-521 AACGCACUUCCCUUUAGAGUGU
ENST00000013894 MI0003160 hsa-miR-524-3p GAAGGCGCUUCCCUUUGGAGU
ENST00000013894 MI0003152 hsa-miR-525-3p GAAGGCGCUUCCCUUUAGAGCG
ENST00000013894 MI0003679 hsa-miR-549 UGACAACUAUGGAUGAGCUCU
ENST00000013894 MI0003565 hsa-miR-559 UAAAGUAAAUAUGCACCAAAA
ENST00000013894 MI0003581 hsa-miR-574-5p UGAGUGUGUGUGUGUGAGUGUGU
ENST00000013894 MI0003589 hsa-miR-582-3p UAACUGGUUGAACAACUGAACC
ENST00000013894 MI0003607 hsa-miR-595 GAAGUGUGCCGUGGUGUGUCU
ENST00000013894 MI0003619 hsa-miR-606 AAACUACUGAAAAUCAAAGAU
ENST00000013894 MI0003640 hsa-miR-626 AGCUGUCUGAAAAUGUCUU
ENST00000013894 MI0003656 hsa-miR-641 AAAGACAUAGGAUAGAGUCACCUC
ENST00000013894 MI0003658 hsa-miR-643 ACUUGUAUGCUAGCUCAGGUAG
ENST00000013894 MI0005561 hsa-miR-877 GUAGAGGAGAUGGCGCAGGG
ENST00000013894 MI0005757 hsa-miR-935 CCAGUUACCGCUUCCGCUACCGC
ENST00000013894 MI0005769 hsa-miR-944 AAAUUAUUGUACAUCGGAUGAG
ENST00000013894 MI0002400 mmu-miR-465a-3p GAUCAGGGCCUUUCUAAGUAGA
ENST00000013894 MI0002400 mmu-miR-465a-5p UAUUUAGAAUGGCACUGAUGUGA
ENST00000013894 MI0005498 mmu-miR-465b-5p UAUUUAGAAUGGUGCUGAUCUG
ENST00000013894 MI0005499 mmu-miR-465b-5p UAUUUAGAAUGGUGCUGAUCUG
ENST00000013894 MI0005500 mmu-miR-465c-5p UAUUUAGAAUGGCGCUGAUCUG
ENST00000013894 MI0005501 mmu-miR-465c-5p UAUUUAGAAUGGCGCUGAUCUG
ENST00000013894 MI0002401 mmu-miR-466a-5p UAUGUGUGUGUACAUGUACAUA
ENST00000013894 MI0005502 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENST00000013894 MI0005503 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENST00000013894 MI0005504 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENST00000013894 MI0005505 mmu-miR-466c-5p GAUGUGUGUGUGCAUGUACAUA
ENST00000013894 MI0005546 mmu-miR-466d-5p UGUGUGUGCGUACAUGUACAUG
ENST00000013894 MI0005506 mmu-miR-466e-5p GAUGUGUGUGUACAUGUACAUA
ENST00000013894 MI0005507 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENST00000013894 MI0005508 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENST00000013894 MI0005509 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENST00000013894 MI0006128 mmu-miR-467e AUAAGUGUGAGCAUGUAUAUGU
ENST00000013894 MI0004523 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENST00000013894 MI0004667 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENST00000013894 MI0004668 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENST00000013894 MI0004666 mmu-miR-669b AGUUUUGUGUGCAUGUGCAUGU
ENST00000013894 MI0004638 mmu-miR-679 GGACUGUGAGGUGACUCUUGGU
ENST00000013894 MI0004647 mmu-miR-684 AGUUUUCCCUUCAAGUCAA
ENST00000013894 MI0004648 mmu-miR-684 AGUUUUCCCUUCAAGUCAA
ENST00000013894 MI0004653 mmu-miR-688 UCGCAGGCGACUACUUAUUC
ENST00000013894 MI0004659 mmu-miR-691 AUUCCUGAAGAGAGGCAGAAAA
ENST00000013894 MI0004677 mmu-miR-696 GCGUGUGCUUGCUGUGGG
ENST00000013894 MI0004688 mmu-miR-704 AGACAUGUGCUCUGCUCCUAG
ENST00000013894 MI0005206 mmu-miR-742 GAAAGCCACCAUGCUGGGUAAA
ENST00000013894 MI0004554 mmu-miR-759 GCAGAGUGCAAACAAUUUUGAC
ENST00000013894 MI0005203 mmu-miR-804 UGUGAGUUGUUCCUCACCUGGA
ENST00000013894 MI0005472 mmu-miR-879 AGAGGCUUAUAGCUCUAAGCC
ENST00000013894 MI0005475 mmu-miR-882 AGGAGAGAGUUAGCGCAUUAGU
ENST00000013894 MI0003722 rno-miR-664 UAUUCAUUUACUCCCCAGCCUA
ENST00000013894 MI0003723 rno-miR-664 UAUUCAUUUACUCCCCAGCCUA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Acetaminophen
  • Acetaminophen affects the expression of ABHD5 mRNA
17562736
Dietary Fats
  • Dietary Fats results in decreased expression of ABHD5 mRNA
18042831
palm oil
  • palm oil results in decreased expression of ABHD5 mRNA
18042831
Raloxifene
  • Raloxifene affects the expression of ABHD5 mRNA
14699072

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
CHANARIN-DORFMAN SYNDROME marker
Albuminuria inferred via Raloxifene 17308373, 17451421
Alzheimer Disease inferred via Raloxifene 15800139
Brain Injuries inferred via Raloxifene 16580743
Breast Neoplasms inferred via Raloxifene 17242785, 15758505, 17595753, 16837676, 17440819, 15775269, 16912660, 17893378, 17952589, 17261762, 17049068, 15572757
Carcinoma, Transitional Cell inferred via Raloxifene 17572228
Cardiovascular Diseases inferred via Raloxifene 15775269
Cognition Disorders inferred via Raloxifene 15800139
Depressive Disorder, Major inferred via Raloxifene 17474826
Diabetic Nephropathies inferred via Raloxifene 17308373, 17451421, 15920148
Edema inferred via Raloxifene 15860553
Encephalomyelitis, Autoimmune, Experimental inferred via Raloxifene 15845917
Fatty Liver inferred via Raloxifene 17473493
Heart Diseases inferred via Raloxifene 11110106
Hypertension inferred via Raloxifene 15787275, 17577099
Leiomyoma inferred via Raloxifene 16973256
Mixed Tumor, Mullerian inferred via Raloxifene 15863610
Multiple Myeloma inferred via Raloxifene 16497877
Myxoma inferred via Raloxifene 16343187
Osteoporosis inferred via Raloxifene 15775268, 17882678
Osteoporosis, Postmenopausal inferred via Raloxifene 15758505, 17893378, 17823083, 15579764
Prostatic Neoplasms inferred via Raloxifene 16220300, 15731164, 16536755
Purpura inferred via Raloxifene 15770314
Stroke inferred via Raloxifene 16837676
Urinary Bladder Neoplasms inferred via Raloxifene 17572228
Venous Thromboembolism inferred via Raloxifene 16837676
Vulvar Neoplasms inferred via Raloxifene 16343187
Arteriosclerosis inferred via Dietary Fats 15238619
Dyslipidemias inferred via Dietary Fats 18367378
Insulin Resistance inferred via Dietary Fats 18457598
Obesity inferred via Dietary Fats 18457598, 17217161
Hepatitis, Toxic inferred via Acetaminophen 2444490, 17522070, 14986274, 16227642, 15968718, 16177239, 17562736, 16081117
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Akiyama M, et al. (2008) "CGI-58 is an alpha/beta-hydrolase within lipid transporting lamellar granules of differentiated keratinocytes." Am J Pathol. 173(5):1349-1360. PMID:18832586
  2. [ + ] Ghosh AK, et al. (2008) "CGI-58, the causative gene for Chanarin-Dorfman syndrome, mediates acylation of lysophosphatidic acid." J Biol Chem. 283(36):24525-24533. PMID:18606822
  3. [ + ] Bruno C, et al. (2008) "Clinical and genetic characterization of Chanarin-Dorfman syndrome." Biochem Biophys Res Commun. 369(4):1125-1128. PMID:18339307
  4. [ + ] Yamaguchi T, et al. (2007) "CGI-58 facilitates lipolysis on lipid droplets but is not involved in the vesiculation of lipid droplets caused by hormonal stimulation." J Lipid Res. 48(5):1078-1089. PMID:17308334
  5. [ + ] Fischer J, et al. (2007) "[Neutral lipid storage diseases and ATGL (adipose triglyceride lipase) and CGI-58/ABHD5 (alpha-beta hydrolase domain-containing 5) deficiency: myopathy, ichthyosis, but no obesity]" Med Sci (Paris). 23(6-7):575-578. PMID:17631826
  6. [ + ] Ben Selma Z, et al. (2007) "A novel S115G mutation of CGI-58 in a Turkish patient with Dorfman-Chanarin syndrome." J Invest Dermatol. 127(9):2273-2276. PMID:17495960
  7. [ + ] Lass A, et al. (2006) "Adipose triglyceride lipase-mediated lipolysis of cellular fat stores is activated by CGI-58 and defective in Chanarin-Dorfman Syndrome." Cell Metab. 3(5):309-319. PMID:16679289
  8. [ + ] Schleinitz N, et al. (2005) "Two new mutations of the ABHD5 gene in a new adult case of Chanarin Dorfman syndrome: an uncommon lipid storage disease." Arch Dermatol. 141(6):798-800. PMID:15967942
  9. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  10. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  11. [ + ] Lefevre C, et al. (2001) "Mutations in CGI-58, the gene encoding a new protein of the esterase/lipase/thioesterase subfamily, in Chanarin-Dorfman syndrome." Am J Hum Genet. 69(5):1002-1012. PMID:11590543
  12. [ + ] Lai CH, et al. (2000) "Identification of novel human genes evolutionarily conserved in Caenorhabditis elegans by comparative proteomics." Genome Res. 10(5):703-713. PMID:10810093
  13. [ + ] Yu W, et al. (1997) "Large-scale concatenation cDNA sequencing." Genome Res. 7(4):353-358. PMID:9110174
  14. [ + ] Andersson B, et al. (1996) "A "double adaptor" method for improved shotgun library construction." Anal Biochem. 236(1):107-113. PMID:8619474