AARS | GeneID:510933 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 510933 Official Symbol AARS
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description alanyl-tRNA synthetase
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 1213

ID Symbol Protein Species
GeneID:16 AARS NP_001596.2 Homo sapiens
GeneID:34156 Aats-ala NP_523511.2 Drosophila melanogaster
GeneID:171985 ars-2 NP_491281.1 Caenorhabditis elegans
GeneID:234734 Aars NP_666329.2 Mus musculus
GeneID:292023 Aars XP_214690.3 Rattus norvegicus
GeneID:324940 aars NP_001037775.1 Danio rerio
GeneID:415668 AARS NP_001005836.1 Gallus gallus
GeneID:454210 AARS XP_001169474.1 Pan troglodytes
GeneID:479656 AARS XP_536788.2 Canis lupus familiaris
GeneID:510933 AARS XP_588170.3 Bos taurus
GeneID:814313 PF13_0354 XP_001350388.1 Plasmodium falciparum
GeneID:841442 ALATS NP_175439.2 Arabidopsis thaliana
GeneID:854513 ALA1 NP_014980.1 Saccharomyces cerevisiae
GeneID:1279087 AgaP_AGAP009701 XP_318757.2 Anopheles gambiae
GeneID:2542031 SPAC23C11.09 NP_593640.1 Schizosaccharomyces pombe
GeneID:2676649 MGG_03607 XP_361064.2 Magnaporthe grisea
GeneID:2713811 NCU02566.1 XP_331765.1 Neurospora crassa
GeneID:2894909 KLLA0F02431g XP_455190.1 Kluyveromyces lactis
GeneID:4348211 Os10g0182000 NP_001064254.1 Oryza sativa
GeneID:4620624 AGOS_ADR363C NP_984459.1 Eremothecium gossypii

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001101075 NP_001094545

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000026393 MI0005458 bta-miR-15a UAGCAGCACAUAAUGGUUUGU
ENSBTAT00000026393 MI0005031 bta-miR-17-3p ACUGCAGUGAAGGCACUUGU
ENSBTAT00000026393 MI0005038 bta-miR-200c UAAUACUGCCGGGUAAUGAUGGA
ENSBTAT00000026393 MI0005067 bta-miR-25 CAUUGCACUUGUCUCGGUCUGA
ENSBTAT00000026393 MI0005069 bta-miR-363 AUUGCACGGUAUCCAUCUGCG
ENSBTAT00000026393 MI0005021 bta-miR-380-3p UAUGUAAUGUGGUCCACGUCU
ENSBTAT00000026393 MI0005024 bta-miR-92 UAUUGCACUUGUCCCGGCCUGU
ENSBTAT00000026393 MI0004751 bta-miR-99a AACCCGUAGAUCCGAUCUUGU
ENSBTAT00000026393 MI0005469 bta-miR-99b CACCCGUAGAACCGACCUUGCG
ENSBTAT00000026393 MI0004997 gga-miR-456 CAGGCUGGUUAGAUGGUUGUCA
ENSBTAT00000026393 MI0000102 hsa-miR-100 AACCCGUAGAUCCGAACUUGUG
ENSBTAT00000026393 MI0000273 hsa-miR-183 UAUGGCACUGGUAGAAUUCACU
ENSBTAT00000026393 MI0000481 hsa-miR-184 UGGACGGAGAACUGAUAAGGGU
ENSBTAT00000026393 MI0005569 hsa-miR-216b AAAUCUCUGCAGGCAAAUGUGA
ENSBTAT00000026393 MI0000090 hsa-miR-32 UAUUGCACAUUACUAAGUUGCA
ENSBTAT00000026393 MI0000775 hsa-miR-367 AAUUGCACUUUAGCAAUGGUGA
ENSBTAT00000026393 MI0000778 hsa-miR-370 GCCUGCUGGGGUGGAACCUGGU
ENSBTAT00000026393 MI0001733 hsa-miR-452 AACUGUUUGCAGAGGAAACUGA
ENSBTAT00000026393 MI0002467 hsa-miR-483-5p AAGACGGGAGGAAAGAAGGGAG
ENSBTAT00000026393 MI0003125 hsa-miR-490-5p CCAUGGAUCUCCAGGUGGGU
ENSBTAT00000026393 MI0003136 hsa-miR-496 UGAGUAUUACAUGGCCAAUCUC
ENSBTAT00000026393 MI0003143 hsa-miR-520e AAAGUGCUUCCUUUUUGAGGG
ENSBTAT00000026393 MI0003177 hsa-miR-522 AAAAUGGUUCCCUUUAGAGUGU
ENSBTAT00000026393 MI0003563 hsa-miR-557 GUUUGCACGGGUGGGCCUUGUCU
ENSBTAT00000026393 MI0003607 hsa-miR-595 GAAGUGUGCCGUGGUGUGUCU
ENSBTAT00000026393 MI0003641 hsa-miR-627 GUGAGUCUCUAAGAAAAGAGGA
ENSBTAT00000026393 MI0003666 hsa-miR-651 UUUAGGAUAAGCUUGACUUUUG
ENSBTAT00000026393 MI0003667 hsa-miR-652 AAUGGCGCCACUAGGGUUGUG
ENSBTAT00000026393 MI0005416 hsa-miR-675 UGGUGCGGAGAGGGCCCACAGUG
ENSBTAT00000026393 MI0003906 hsa-miR-802 CAGUAACAAAGAUUCAUCCUUGU
ENSBTAT00000026393 MI0005493 mmu-miR-327 ACUUGAGGGGCAUGAGGAU
ENSBTAT00000026393 MI0005494 mmu-miR-343 UCUCCCUUCAUGUGCCCAGA
ENSBTAT00000026393 MI0006128 mmu-miR-467e AUAAGUGUGAGCAUGUAUAUGU
ENSBTAT00000026393 MI0004653 mmu-miR-688 UCGCAGGCGACUACUUAUUC
ENSBTAT00000026393 MI0004698 mmu-miR-713 UGCACUGAAGGCACACAGC
ENSBTAT00000026393 MI0005472 mmu-miR-879 AGAGGCUUAUAGCUCUAAGCC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene