ABHD1 | GeneID:510774 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 510774 Official Symbol ABHD1
Locus N/A Gene Type protein-coding
Synonyms MGC127615
Full Name N/A
Description abhydrolase domain containing 1
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 115638

ID Symbol Protein Species
GeneID:84696 ABHD1 NP_115993.2 Homo sapiens
GeneID:313917 Abhd1 NP_001008520.1 Rattus norvegicus
GeneID:470337 ABHD1 XP_525719.2 Pan troglodytes
GeneID:510774 ABHD1 NP_001030266.1 Bos taurus
GeneID:835059 AT5G49950 NP_199806.1 Arabidopsis thaliana
GeneID:2894340 KLLA0E24244g XP_455042.1 Kluyveromyces lactis
GeneID:4619253 AGOS_ABR194C NP_983143.1 Eremothecium gossypii

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0004091 Function carboxylesterase activity
GO:0016787 Function hydrolase activity

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001035094 NP_001030266

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000009303 MI0004750 bta-miR-499 UUAAGACUUGCAGUGAUGUUU
ENSBTAT00000009303 MI0005056 bta-miR-7 UGGAAGACUAGUGAUUUUGUUGUU
ENSBTAT00000009303 MI0000747 hsa-miR-296-3p GAGGGUUGGGUGGAGGCUCUCC
ENSBTAT00000009303 MI0005525 hsa-miR-300 UAUACAAGGGCAGACUCUCUCU
ENSBTAT00000009303 MI0000786 hsa-miR-378 ACUGGACUUGGAGUCAGAAGG
ENSBTAT00000009303 MI0001444 hsa-miR-422a ACUGGACUUAGGGUCAGAAGGC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932