ABCG1 | GeneID:510745 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 510745 Official Symbol ABCG1
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family G (WHITE), member 1
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 21022

ID Symbol Protein Species
GeneID:9619 ABCG1 NP_004906.3 Homo sapiens
GeneID:11307 Abcg1 NP_033723.1 Mus musculus
GeneID:33636 Atet NP_001097078.1 Drosophila melanogaster
GeneID:85264 Abcg1 NP_445954.1 Rattus norvegicus
GeneID:178182 wht-5 NP_502352.1 Caenorhabditis elegans
GeneID:190068 wht-9 NP_499616.1 Caenorhabditis elegans
GeneID:418533 ABCG1 XP_416742.2 Gallus gallus
GeneID:458577 ABCG1 XP_514918.2 Pan troglodytes
GeneID:487777 ABCG1 XP_544902.2 Canis lupus familiaris
GeneID:510745 ABCG1 XP_587930.3 Bos taurus
GeneID:556979 zgc:162197 NP_001103924.1 Danio rerio
GeneID:840064 AT1G31770 NP_564383.1 Arabidopsis thaliana
GeneID:1281268 AgaP_AGAP001858 XP_550960.1 Anopheles gambiae
GeneID:4344750 Os08g0167000 NP_001061077.1 Oryza sativa

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_587930 XP_587930

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000028342 MI0004740 bta-miR-18a UAAGGUGCAUCUAGUGCAGAUA
ENSBTAT00000028342 MI0004732 bta-miR-18b UAAGGUGCAUCUAGUGCAGUUA
ENSBTAT00000028342 MI0004743 bta-miR-221 AGCUACAUUGUCUGCUGGGUUU
ENSBTAT00000028342 MI0000482 hsa-miR-185 UGGAGAGAAAGGCAGUUCCUGA
ENSBTAT00000028342 MI0003130 hsa-miR-202 AGAGGUAUAGGGCAUGGGAA
ENSBTAT00000028342 MI0000806 hsa-miR-337-5p GAACGGCUUCAUACAGGAGUU
ENSBTAT00000028342 MI0001145 hsa-miR-384 AUUCCUAGAAAUUGUUCAUA
ENSBTAT00000028342 MI0003127 hsa-miR-511 GUGUCUUUUGCUCUGCAGUCA
ENSBTAT00000028342 MI0003128 hsa-miR-511 GUGUCUUUUGCUCUGCAGUCA
ENSBTAT00000028342 MI0003161 hsa-miR-517a AUCGUGCAUCCCUUUAGAGUGU
ENSBTAT00000028342 MI0003174 hsa-miR-517c AUCGUGCAUCCUUUUAGAGUGU
ENSBTAT00000028342 MI0003515 hsa-miR-544 AUUCUGCAUUUUUAGCAAGUUC
ENSBTAT00000028342 MI0003633 hsa-miR-619 GACCUGGACAUGUUUGUGCCCAGU
ENSBTAT00000028342 MI0003640 hsa-miR-626 AGCUGUCUGAAAAUGUCUU
ENSBTAT00000028342 MI0005541 hsa-miR-875-3p CCUGGAAACACUGAGGUUGUG
ENSBTAT00000028342 MI0005768 hsa-miR-943 CUGACUGUUGCCGUCCUCCAG
ENSBTAT00000028342 MI0002406 mmu-miR-471 UACGUAGUAUAGUGCUUUUCAC
ENSBTAT00000028342 MI0004640 mmu-miR-680 GGGCAUCUGCUGACAUGGGGG
ENSBTAT00000028342 MI0004641 mmu-miR-680 GGGCAUCUGCUGACAUGGGGG
ENSBTAT00000028342 MI0004642 mmu-miR-680 GGGCAUCUGCUGACAUGGGGG
ENSBTAT00000028342 MI0005205 mmu-miR-741 UGAGAGAUGCCAUUCUAUGUAGA
ENSBTAT00000028342 MI0005204 mmu-miR-805 GAAUUGAUCAGGACAUAGGG
ENSBTAT00000028342 MI0000613 rno-miR-336 UCACCCUUCCAUAUCUAGUCU
ENSBTAT00000028342 MI0000635 rno-miR-347 UGUCCCUCUGGGUCGCCCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_587930  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene