ABCA5 | GeneID:510497 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 510497 Official Symbol ABCA5
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family A (ABC1), member 5
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 10263

ID Symbol Protein Species
GeneID:23461 ABCA5 NP_061142.2 Homo sapiens
GeneID:217265 Abca5 NP_671752.1 Mus musculus
GeneID:286970 Abca5 NP_775429.1 Rattus norvegicus
GeneID:417444 ABCA5 XP_415695.2 Gallus gallus
GeneID:454848 ABCA5 XP_001166542.1 Pan troglodytes
GeneID:480455 ABCA5 XP_537573.2 Canis lupus familiaris
GeneID:510497 ABCA5 XP_587636.3 Bos taurus
GeneID:1272631 AgaP_AGAP010416 XP_311531.2 Anopheles gambiae
GeneID:100151075 LOC100151075 XP_001918691.1 Danio rerio

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_587636 XP_587636

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000003563 MI0005007 bta-miR-10a UACCCUGUAGAUCCGAAUUUGUG
ENSBTAT00000003563 MI0005052 bta-miR-10b UACCCUGUAGAACCGAAUUUGUG
ENSBTAT00000003563 MI0004738 bta-miR-151* UCGAGGAGCUCACAGUCUAGU
ENSBTAT00000003563 MI0005037 bta-miR-200a UAACACUGUCUGGUAACGAUGUU
ENSBTAT00000003563 MI0000457 hsa-miR-141 UAACACUGUCUGGUAAAGAUGG
ENSBTAT00000003563 MI0000460 hsa-miR-144 UACAGUAUAGAUGAUGUACU
ENSBTAT00000003563 MI0000480 hsa-miR-154 UAGGUUAUCCGUGUUGCCUUCG
ENSBTAT00000003563 MI0005525 hsa-miR-300 UAUACAAGGGCAGACUCUCUCU
ENSBTAT00000003563 MI0003124 hsa-miR-489 GUGACAUCACAUAUACGGCAGC
ENSBTAT00000003563 MI0003190 hsa-miR-505 CGUCAACACUUGCUGGUUUCCU
ENSBTAT00000003563 MI0003590 hsa-miR-583 CAAAGAGGAAGGUCCCAUUAC
ENSBTAT00000003563 MI0003631 hsa-miR-617 AGACUUCCCAUUUGAAGGUGGC
ENSBTAT00000003563 MI0005541 hsa-miR-875-5p UAUACCUCAGUUUUAUCAGGUG
ENSBTAT00000003563 MI0002637 mml-miR-189 GUGCCUACUGAGCUGAUAUCAGU
ENSBTAT00000003563 MI0000389 mmu-miR-291a-5p CAUCAAAGUGGAGGCCCUCUCU
ENSBTAT00000003563 MI0003539 mmu-miR-291b-5p GAUCAAAGUGGAGGCCCUCUCC
ENSBTAT00000003563 MI0001526 mmu-miR-434-5p GCUCGACUCAUGGUUUGAACCA
ENSBTAT00000003563 MI0004638 mmu-miR-679 GGACUGUGAGGUGACUCUUGGU
ENSBTAT00000003563 MI0004681 mmu-miR-697 AACAUCCUGGUCCUGUGGAGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

XM_587636  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene