ABHD11 | GeneID:510109 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 510109 Official Symbol ABHD11
Locus N/A Gene Type protein-coding
Synonyms MGC128235
Full Name N/A
Description abhydrolase domain containing 11
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 5961

ID Symbol Protein Species
GeneID:31663 CG2059 NP_572388.1 Drosophila melanogaster
GeneID:68758 Abhd11 NP_660250.1 Mus musculus
GeneID:83451 ABHD11 NP_683710.1 Homo sapiens
GeneID:173096 R05D7.4 NP_493077.1 Caenorhabditis elegans
GeneID:185192 F32B4.6 NP_492942.1 Caenorhabditis elegans
GeneID:360831 Abhd11 XP_341105.1 Rattus norvegicus
GeneID:417473 ABHD11 XP_415721.2 Gallus gallus
GeneID:446169 abhd11 NP_001004290.1 Danio rerio
GeneID:472412 ABHD11 XP_001147903.1 Pan troglodytes
GeneID:489803 ABHD11 XP_546921.1 Canis lupus familiaris
GeneID:510109 ABHD11 NP_001029544.1 Bos taurus
GeneID:686139 LOC686139 XP_001066660.1 Rattus norvegicus
GeneID:810986 PF11_0441 XP_001348110.1 Plasmodium falciparum
GeneID:852919 YGR031W NP_011545.1 Saccharomyces cerevisiae
GeneID:1280255 AgaP_AGAP009289 XP_320086.1 Anopheles gambiae
GeneID:2541745 SPAC22H12.03 NP_593115.1 Schizosaccharomyces pombe
GeneID:2685094 MGG_06921 XP_370424.2 Magnaporthe grisea
GeneID:2709957 NCU01454.1 XP_327893.1 Neurospora crassa
GeneID:2897458 KLLA0B05863g XP_451797.1 Kluyveromyces lactis
GeneID:4619344 AGOS_ACL180C NP_983224.1 Eremothecium gossypii

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016787 Function hydrolase activity

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001034372 NP_001029544

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000013668 MI0005063 bta-miR-122 UGGAGUGUGACAAUGGUGUUUG
ENSBTAT00000013668 MI0005019 bta-miR-345 GCUGACUCCUAGUCCAGUGCU
ENSBTAT00000013668 MI0005465 bta-miR-365 UAAUGCCCCUAAAAAUCCUUAU
ENSBTAT00000013668 MI0005061 bta-miR-532 CAUGCCUUGAGUGUAGGACCGU
ENSBTAT00000013668 MI0005544 hsa-miR-147b GUGUGCGGAAAUGCUUCUGCUA
ENSBTAT00000013668 MI0000747 hsa-miR-296-5p AGGGCCCCCCCUCAAUCCUGU
ENSBTAT00000013668 MI0005523 hsa-miR-298 AGCAGAAGCAGGGAGGUUCUCCCA
ENSBTAT00000013668 MI0000804 hsa-miR-328 CUGGCCCUCUCUGCCCUUCCGU
ENSBTAT00000013668 MI0000783 hsa-miR-375 UUUGUUCGUUCGGCUCGCGUGA
ENSBTAT00000013668 MI0003133 hsa-miR-432 UCUUGGAGUAGGUCAUUGGGUGG
ENSBTAT00000013668 MI0003184 hsa-miR-500 UAAUCCUUGCUACCUGGGUGAGA
ENSBTAT00000013668 MI0003127 hsa-miR-511 GUGUCUUUUGCUCUGCAGUCA
ENSBTAT00000013668 MI0003128 hsa-miR-511 GUGUCUUUUGCUCUGCAGUCA
ENSBTAT00000013668 MI0003149 hsa-miR-520a-3p AAAGUGCUUCCCUUUGGACUGU
ENSBTAT00000013668 MI0003155 hsa-miR-520b AAAGUGCUUCCUUUUAGAGGG
ENSBTAT00000013668 MI0003158 hsa-miR-520c-3p AAAGUGCUUCCUUUUAGAGGGU
ENSBTAT00000013668 MI0003164 hsa-miR-520d-3p AAAGUGCUUCUCUUUGGUGGGU
ENSBTAT00000013668 MI0003143 hsa-miR-520e AAAGUGCUUCCUUUUUGAGGG
ENSBTAT00000013668 MI0003146 hsa-miR-520f AAGUGCUUCCUUUUAGAGGGUU
ENSBTAT00000013668 MI0003596 hsa-miR-548b-3p CAAGAACCUCAGUUGCUUUUGU
ENSBTAT00000013668 MI0003668 hsa-miR-548d-3p CAAAAACCACAGUUUCUUUUGC
ENSBTAT00000013668 MI0003671 hsa-miR-548d-3p CAAAAACCACAGUUUCUUUUGC
ENSBTAT00000013668 MI0003567 hsa-miR-561 CAAAGUUUAAGAUCCUUGAAGU
ENSBTAT00000013668 MI0003572 hsa-miR-566 GGGCGCCUGUGAUCCCAAC
ENSBTAT00000013668 MI0003579 hsa-miR-572 GUCCGCUCGGCGGUGGCCCA
ENSBTAT00000013668 MI0003594 hsa-miR-586 UAUGCAUUGUAUUUUUAGGUCC
ENSBTAT00000013668 MI0003635 hsa-miR-621 GGCUAGCAACAGCGCUUACCU
ENSBTAT00000013668 MI0003669 hsa-miR-661 UGCCUGGGUCUCUGGCCUGCGCGU
ENSBTAT00000013668 MI0005716 hsa-miR-924 AGAGUCUUGUGAUGUCUUGC
ENSBTAT00000013668 MI0005760 hsa-miR-938 UGCCCUUAAAGGUGAACCCAGU
ENSBTAT00000013668 MI0002404 mmu-miR-469 UGCCUCUUUCAUUGAUCUUGGUGUCC
ENSBTAT00000013668 MI0004654 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC
ENSBTAT00000013668 MI0004655 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC
ENSBTAT00000013668 MI0004682 mmu-miR-698 CAUUCUCGUUUCCUUCCCU
ENSBTAT00000013668 MI0003722 rno-miR-664 UAUUCAUUUACUCCCCAGCCUA
ENSBTAT00000013668 MI0003723 rno-miR-664 UAUUCAUUUACUCCCCAGCCUA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932