ACOX1 | GeneID:51 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 51 Official Symbol ACOX1
Locus N/A Gene Type protein-coding
Synonyms ACOX; MGC1198; PALMCOX; SCOX
Full Name acyl-Coenzyme A oxidase 1, palmitoyl
Description acyl-Coenzyme A oxidase 1, palmitoyl
Chromosome 17q24-q25|17q25.1
Also Known As acyl-CoA oxidase, straight-chain; acyl-Coenzyme A oxidase 1; peroxisomal fatty acyl-CoA oxidase
Summary The protein encoded by this gene is the first enzyme of the fatty acid beta-oxidation pathway, which catalyzes the desaturation of acyl-CoAs to 2-trans-enoyl-CoAs. It donates electrons directly to molecular oxygen, thereby producing hydrogen peroxide. Defects in this gene result in pseudoneonatal adrenoleukodystrophy, a disease that is characterized by accumulation of very long chain fatty acids. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 38299

ID Symbol Protein Species
GeneID:51 ACOX1 NP_009223.2 Homo sapiens
GeneID:11430 Acox1 NP_056544.2 Mus musculus
GeneID:37028 CG5009 NP_611264.2 Drosophila melanogaster
GeneID:50681 Acox1 NP_059036.1 Rattus norvegicus
GeneID:173162 F08A8.1 NP_001021089.1 Caenorhabditis elegans
GeneID:173163 F08A8.2 NP_493262.1 Caenorhabditis elegans
GeneID:173164 F08A8.4 NP_493264.1 Caenorhabditis elegans
GeneID:176353 C48B4.1 NP_499119.1 Caenorhabditis elegans
GeneID:180376 F25C8.1 NP_508036.1 Caenorhabditis elegans
GeneID:181668 F59F4.1 NP_510603.1 Caenorhabditis elegans
GeneID:184167 F08A8.3 NP_493263.1 Caenorhabditis elegans
GeneID:417366 ACOX1 NP_001006205.1 Gallus gallus
GeneID:449662 acox1 NP_001005933.1 Danio rerio
GeneID:454895 ACOX1 XP_001149084.1 Pan troglodytes
GeneID:483322 ACOX1 XP_540441.2 Canis lupus familiaris
GeneID:513996 ACOX1 NP_001030366.1 Bos taurus
GeneID:818138 ACX5 NP_181112.1 Arabidopsis thaliana
GeneID:827381 ACX1 NP_567513.1 Arabidopsis thaliana
GeneID:1280851 AgaP_AGAP011798 XP_320717.2 Anopheles gambiae
GeneID:4339846 Os06g0103500 NP_001056542.1 Oryza sativa

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab59964 ACOX1 antibody - Aminoterminal end (ab59964); Rabbit polyclonal to ACOX1 - Aminoterminal end
2 abcam ab71483 ACOX1 antibody - C-terminal (ab71483); Rabbit polyclonal to ACOX1 - C-terminal
3 abcam ab37740 ACOX1 antibody (ab37740); Chicken polyclonal to ACOX1
4 abgent AP2523b ACOX1 Antibody (C-term); Purified Rabbit Polyclonal Antibody (Pab)
5 abgent AP2523a ACOX1 Antibody (N-term); Purified Rabbit Polyclonal Antibody (Pab)
6 acris AP12248PU-N ACOX1 (C-term); antibody Ab
7 acris AP12247PU-N ACOX1 (N-term); antibody Ab

Exon, Intron and UTRs

Exon, Intron and UTRs of ACOX1 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ACOX1 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0005739 Component mitochondrion
GO:0005778 Component peroxisomal membrane
GO:0005777 Component peroxisome
GO:0003995 Function acyl-CoA dehydrogenase activity
GO:0003997 Function acyl-CoA oxidase activity
GO:0009055 Function electron carrier activity
GO:0050660 Function FAD binding
GO:0047485 Function protein N-terminus binding
GO:0006635 Process fatty acid beta-oxidation
GO:0006091 Process generation of precursor metabolites and energy
GO:0006629 Process lipid metabolic process
GO:0055114 Process oxidation reduction
GO:0006693 Process prostaglandin metabolic process
GO:0007283 Process spermatogenesis

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_004035  UCSC Browser NP_004026
2 NM_007292  UCSC Browser NP_009223

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000293217 MI0000064 hsa-let-7c* UAGAGUUACACCCUGGGAGUUA
ENST00000293217 MI0000108 hsa-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENST00000293217 MI0000109 hsa-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENST00000293217 MI0000114 hsa-miR-107 AGCAGCAUUGUACAGGGCUAUCA
ENST00000293217 MI0000457 hsa-miR-141 UAACACUGUCUGGUAAAGAUGG
ENST00000293217 MI0000809 hsa-miR-151-3p CUAGACUGAAGCUCCUUGAGG
ENST00000293217 MI0000737 hsa-miR-200a UAACACUGUCUGGUAACGAUGU
ENST00000293217 MI0000296 hsa-miR-219-5p UGAUUGUCCAAACGCAAUUCU
ENST00000293217 MI0000740 hsa-miR-219-5p UGAUUGUCCAAACGCAAUUCU
ENST00000293217 MI0000300 hsa-miR-223 UGUCAGUUUGUCAAAUACCCCA
ENST00000293217 MI0000082 hsa-miR-25 CAUUGCACUUGUCUCGGUCUGA
ENST00000293217 MI0000764 hsa-miR-363 AAUUGCACGGUAUCCAUCUGUA
ENST00000293217 MI0000775 hsa-miR-367 AAUUGCACUUUAGCAAUGGUGA
ENST00000293217 MI0002401 mmu-miR-466a-3p UAUACAUACACGCACACAUAAGA
ENST00000293217 MI0005546 mmu-miR-466d-3p UAUACAUACACGCACACAUAG
ENST00000293217 MI0004662 mmu-miR-693-5p CAGCCACAUCCGAAAGUUUUC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
1-Naphthylisothiocyanate
  • 1-Naphthylisothiocyanate results in increased expression of ACOX1 mRNA
12883083
(2E,4E,6E,10E)-3,7,11,15-tetramethyl-2,4,6,10,14-hexadecapentaenoic acid
  • (2E,4E,6E,10E)-3,7,11,15-tetramethyl-2,4,6,10,14-hexadecapentaenoic acid results in decreased expression of ACOX1 mRNA
17261273
4-hydroxy-equilenin
  • 4-hydroxy-equilenin results in decreased expression of ACOX1 mRNA
15135645
4-tert-octylphenol
  • 4-tert-octylphenol results in increased activity of ACOX1 protein
16002344
Acetaminophen
  • Acetaminophen affects the expression of ACOX1 mRNA
17562736
bexarotene
  • bexarotene results in increased expression of ACOX1 mRNA
16648578
Bezafibrate
  • Bezafibrate results in increased expression of ACOX1 mRNA
15447978
Bezafibrate
  • Bezafibrate results in increased expression of ACOX1 mRNA
16707586
Cadmium
  • Cadmium results in decreased expression of ACOX1 mRNA
17066326
Cadmium Chloride
  • Cadmium Chloride results in decreased expression of ACOX1 mRNA
17066326
Carbon Tetrachloride
  • Carbon Tetrachloride affects the expression of ACOX1 mRNA
15963342
Clofenapate
  • Clofenapate results in increased expression of ACOX1 mRNA
12971794
Clofibric Acid
  • Clofibric Acid results in increased expression of ACOX1 mRNA
15670589
Clofibric Acid
  • Clofibric Acid results in increased activity of ACOX1 protein
10630566
Clofibric Acid
  • Clofibric Acid affects the expression of ACOX1 mRNA
  • [Diethylnitrosamine co-treated with Clofibric Acid] affects the expression of ACOX1 mRNA
17602206
Dehydroepiandrosterone
  • Dehydroepiandrosterone results in increased expression of ACOX1 mRNA
16940010
Dexamethasone
  • Dexamethasone results in decreased expression of ACOX1 mRNA
12971794
Dibutyl Phthalate
  • Dibutyl Phthalate results in increased activity of ACOX1 protein
16002344
dicyclanil
  • dicyclanil results in increased expression of ACOX1 mRNA
15664270
Dietary Fats
  • Dietary Fats results in increased expression of ACOX1 mRNA
18457598, 15238619
diethyl maleate
  • diethyl maleate inhibits the reaction [PPARA protein binds to ACOX1 promoter]
  • resveratrol inhibits the reaction [diethyl maleate inhibits the reaction [PPARA protein binds to ACOX1 promoter]]
  • resveratrol promotes the reaction [diethyl maleate inhibits the reaction [PPARA protein binds to ACOX1 promoter]]
17134953
Diethylnitrosamine
  • [Diethylnitrosamine co-treated with Clofibric Acid] affects the expression of ACOX1 mRNA
17602206
Estradiol
  • Estradiol results in increased activity of ACOX1 protein
16002344
Ethinyl Estradiol
  • Ethinyl Estradiol results in increased activity of ACOX1 protein
16002344
Fatty Acids, Omega-3
  • Fatty Acids, Omega-3 results in increased activity of ACOX1 protein
  • Fatty Acids, Omega-3 results in increased expression of ACOX1 mRNA
15949695
fenvalerate
  • fenvalerate metabolite results in increased activity of ACOX1 protein
10630566
Methotrexate
  • Methotrexate results in decreased expression of ACOX1 mRNA
15120968
Methoxychlor
  • Methoxychlor results in increased activity of ACOX1 protein
16002344
Methylmercury Compounds
  • Methylmercury Compounds results in increased expression of ACOX1 mRNA
16966085
Orotic Acid
  • [Sucrose co-treated with Orotic Acid] does not affect the expression of ACOX1 mRNA
15670589
perfluorooctanoic acid
  • perfluorooctanoic acid affects the activity of ACOX1 protein
15352480
perfluorooctanoic acid
  • perfluorooctanoic acid results in increased expression of ACOX1 mRNA
8011682
perfluorooctanoic acid
  • perfluorooctanoic acid results in increased expression of ACOX1 mRNA
17681415
perfluorooctanoic acid
  • perfluorooctanoic acid results in increased activity of ACOX1 protein
14757943
pirinixic acid
  • pirinixic acid results in increased expression of ACOX1 mRNA
18301758, 17426115, 15375163
pirinixic acid
  • pirinixic acid results in increased expression of ACOX1 mRNA
16940010, 16707586
Polychlorinated Biphenyls
  • Polychlorinated Biphenyls results in increased activity of ACOX1 protein
16764481
Procetofen
  • Procetofen results in increased expression of ACOX1 mRNA
16707586
resveratrol
  • resveratrol inhibits the reaction [diethyl maleate inhibits the reaction [PPARA protein binds to ACOX1 promoter]]
  • resveratrol promotes the reaction [diethyl maleate inhibits the reaction [PPARA protein binds to ACOX1 promoter]]
17134953
Sucrose
  • [Sucrose co-treated with Orotic Acid] does not affect the expression of ACOX1 mRNA
15670589
Tetrachlorodibenzodioxin
  • Tetrachlorodibenzodioxin results in increased expression of ACOX1 mRNA
15345368
Tetracycline
  • Tetracycline results in increased expression of ACOX1 mRNA
16917069
trans-10,cis-12-conjugated linoleic acid
  • trans-10,cis-12-conjugated linoleic acid results in decreased expression of ACOX1 mRNA
17217560

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
PEROXISOMAL ACYL-CoA OXIDASE DEFICIENCY marker
Fatty Liver inferred via Tetracycline 16917069
Hepatitis, Toxic inferred via Tetracycline 17522070
Nephritis, Interstitial inferred via Tetracycline 9884423
Pemphigoid, Bullous inferred via Tetracycline 11026799
Prion Diseases inferred via Tetracycline 10903871
Adenoma, Liver Cell inferred via Tetrachlorodibenzodioxin 16835633
Carcinoma inferred via Tetrachlorodibenzodioxin 16835633
Cholangiocarcinoma inferred via Tetrachlorodibenzodioxin 16835633
Cleft Palate inferred via Tetrachlorodibenzodioxin 8697196
Diabetes Mellitus, Type 2 inferred via Tetrachlorodibenzodioxin 17107852
Hydronephrosis inferred via Tetrachlorodibenzodioxin 8697196
Liver Neoplasms inferred via Tetrachlorodibenzodioxin 16984957
Adenoma inferred via resveratrol 15688382
Alzheimer Disease inferred via resveratrol 16183991, 16162502
Arthritis, Experimental inferred via resveratrol 17115116
Atherosclerosis inferred via resveratrol 16873680, 17967414
Brain Ischemia inferred via resveratrol 17600658
Breast Neoplasms inferred via resveratrol 17651959, 17534123, 16393696
Carcinoma, Hepatocellular inferred via resveratrol 16227395
Carcinoma, Lewis Lung inferred via resveratrol 16675471
Carcinoma, Squamous Cell inferred via resveratrol 16227395
Cardiovascular Diseases inferred via resveratrol 15458977
Colitis inferred via resveratrol 16474422
Colonic Neoplasms inferred via resveratrol 16338953
Colorectal Neoplasms inferred via resveratrol 16550006
Diabetes Mellitus, Experimental inferred via resveratrol 16873680
Diabetic Nephropathies inferred via resveratrol 16286809
Edema inferred via resveratrol 8985016
Encephalomyelitis, Autoimmune, Experimental inferred via resveratrol 17872969
Enterocolitis, Necrotizing inferred via resveratrol 17923197
Herpes Simplex inferred via resveratrol 16876885
Hypercholesterolemia inferred via resveratrol 17188708
Hyperlipidemias inferred via resveratrol 16873680
Hypertrophy, Left Ventricular inferred via resveratrol 17488730
Infarction, Middle Cerebral Artery inferred via resveratrol 17600658
Inflammation inferred via resveratrol 16366677
Influenza, Human inferred via resveratrol 16624496
Kidney Failure, Acute inferred via resveratrol 16538975
Leukemia, Promyelocytic, Acute inferred via resveratrol 16087638
Lymphoma, B-Cell inferred via resveratrol 17088997
Lymphoma, Non-Hodgkin inferred via resveratrol 14749477
Mammary Neoplasms, Animal inferred via resveratrol 15688416
Mammary Neoplasms, Experimental inferred via resveratrol 8985016, 11606380
Melanoma inferred via resveratrol 17992120
Metabolic Diseases inferred via resveratrol 17112576
Multiple Myeloma inferred via resveratrol 14749477, 16267019, 16490592, 17935668, 17164350, 17049120
Muscular Atrophy, Spinal inferred via resveratrol 17962980
Myocardial Infarction inferred via resveratrol 17188708, 17125593, 16456233, 16317513, 17015251, 16525036
Myocardial Ischemia inferred via resveratrol 17125593, 17015251
Myocarditis inferred via resveratrol 17322642
Neoplasms, Experimental inferred via resveratrol 8985016
Neurodegenerative Diseases inferred via resveratrol 17652729
Neurogenic Inflammation inferred via resveratrol 17929310
Osteoporosis, Postmenopausal inferred via resveratrol 17513867
Prenatal Exposure Delayed Effects inferred via resveratrol 16679765
Prostatic Neoplasms inferred via resveratrol 17675339, 17636462, 17804756, 16731767, 15767336, 17718901
Renal Insufficiency, Chronic inferred via resveratrol 16325855
Reperfusion Injury inferred via resveratrol 17058453, 17520802, 16314181, 16317513, 15827377
Skin Neoplasms inferred via resveratrol 15837718, 8985016
STROKE, ISCHEMIC inferred via resveratrol 16321402
Tongue Neoplasms inferred via resveratrol 16227395
Uterine Cervical Neoplasms inferred via resveratrol 17473185
Uterine Neoplasms inferred via resveratrol 17044934
Ventricular Dysfunction, Left inferred via resveratrol 17488730
Dyslipidemias inferred via Procetofen 16707586
Endometrial Neoplasms inferred via Procetofen 16569247
Dementia inferred via Polychlorinated Biphenyls 16140633
Parkinson Disease inferred via Polychlorinated Biphenyls 16702228
Prostatic Neoplasms inferred via Polychlorinated Biphenyls 15721890
Edema inferred via pirinixic acid 12083418
Liver Neoplasms inferred via pirinixic acid 15890375
Edema inferred via perfluorooctanoic acid 17259670, 12083418
Hepatomegaly inferred via perfluorooctanoic acid 3609246
Hyperalgesia inferred via perfluorooctanoic acid 12083418
Inflammation inferred via perfluorooctanoic acid 12083418
Leydig Cell Tumor inferred via perfluorooctanoic acid 8812269
Liver Neoplasms inferred via perfluorooctanoic acid 14757943
Niemann-Pick Disease, Type C inferred via perfluorooctanoic acid 9802331
Prenatal Exposure Delayed Effects inferred via perfluorooctanoic acid 17132714
Dementia inferred via Methylmercury Compounds 16140633
Infertility, Male inferred via Methoxychlor 16467254, 11955947
Arthritis, Rheumatoid inferred via Methotrexate 17286800
Breast Neoplasms inferred via Methotrexate 16978400
Graft vs Host Disease inferred via Methotrexate 16518429
Liver Cirrhosis inferred via Methotrexate 14986274
Mucositis inferred via Methotrexate 17488658
Psoriasis inferred via Methotrexate 17410198
Hepatomegaly inferred via fenvalerate 15602828
Neoplasms inferred via fenvalerate 2895627
Inflammation inferred via Fatty Acids, Omega-3 17296493
Acne Vulgaris inferred via Ethinyl Estradiol 17505938
Adenocarcinoma inferred via Ethinyl Estradiol 14692618
Arteriosclerosis inferred via Ethinyl Estradiol 11256880
Arthritis, Experimental inferred via Ethinyl Estradiol 15885639
Cholestasis inferred via Ethinyl Estradiol 17110522, 17333356, 11677210, 15861022, 16105132, 17681005, 16919318
Encephalomyelitis, Autoimmune, Experimental inferred via Ethinyl Estradiol 12538720
Fatty Liver inferred via Ethinyl Estradiol 15345470
Hypospadias inferred via Ethinyl Estradiol 16569931, 16945680
Infertility, Female inferred via Ethinyl Estradiol 12013081
Infertility, Male inferred via Ethinyl Estradiol 17937319
Panic Disorder inferred via Ethinyl Estradiol 11578682
Pruritus inferred via Ethinyl Estradiol 16919318, 15861022
Spermatocele inferred via Ethinyl Estradiol 16709447
Thrombophilia inferred via Ethinyl Estradiol 11994571
Thrombosis inferred via Ethinyl Estradiol 15669648
Uterine Neoplasms inferred via Ethinyl Estradiol 14692618
Venous Thrombosis inferred via Ethinyl Estradiol 15869587
Breast Neoplasms inferred via Estradiol 17289903, 12948864, 17261762, 18497071, 17018787, 14630087
Candidiasis, Vulvovaginal inferred via Estradiol 16111702
Carcinoma, Hepatocellular inferred via Estradiol 16924424
Herpes Genitalis inferred via Estradiol 15709030
Hot Flashes inferred via Estradiol 17088409
Insulin Resistance inferred via Estradiol 16393666, 16627594
Kidney Diseases inferred via Estradiol 15618244
Kidney Neoplasms inferred via Estradiol 15610895
Liver Cirrhosis, Experimental inferred via Estradiol 14716833, 14659978
Mammary Neoplasms, Experimental inferred via Estradiol 17203775, 11807958, 11408345, 16891317
Myocardial Reperfusion Injury inferred via Estradiol 16810080
Neovascularization, Pathologic inferred via Estradiol 17289903
Prostatic Neoplasms inferred via Estradiol 16740699
Adenoma inferred via Diethylnitrosamine 10737359
Carcinoma, Hepatocellular inferred via Diethylnitrosamine 16878318, 10672840, 10737359, 11831363, 17428255
Liver Neoplasms inferred via Diethylnitrosamine 2422723, 12112319, 18648771, 10737359, 16942905, 15885732
Liver Neoplasms, Experimental inferred via Diethylnitrosamine 16267830, 3124819, 16842330
Arteriosclerosis inferred via Dietary Fats 15238619
Dyslipidemias inferred via Dietary Fats 18367378
Insulin Resistance inferred via Dietary Fats 18457598
Obesity inferred via Dietary Fats 18457598, 17217161
Cryptorchidism inferred via Dibutyl Phthalate 16037377
Colonic Neoplasms inferred via Dexamethasone 15824018
Liver Cirrhosis, Experimental inferred via Dexamethasone 16718785
Lung Neoplasms inferred via Dexamethasone 15824018, 11195469
Multiple Myeloma inferred via Dexamethasone 15867202, 15744524, 16118317
Respiratory Distress Syndrome, Adult inferred via Dexamethasone 11700416
Adrenal Insufficiency inferred via Dehydroepiandrosterone 17302879
Diabetes Mellitus, Type 1 inferred via Dehydroepiandrosterone 16616286
Mammary Neoplasms, Experimental inferred via Dehydroepiandrosterone 16457693
Osteoporosis, Postmenopausal inferred via Dehydroepiandrosterone 16397352
Liver Neoplasms inferred via Clofibric Acid 17602206
Carbon Tetrachloride Poisoning inferred via Carbon Tetrachloride 16192424, 16097048, 16011737, 15673190, 16050911, 10355542, 16227642, 16124888, 15700767
Fatty Liver inferred via Carbon Tetrachloride 16045604, 15959796, 12795759, 61145, 12631006, 17595544, 16239168
Hepatitis, Toxic inferred via Carbon Tetrachloride 17522070, 11566570, 15998439, 15027814, 15968718, 16227642, 16177239
Hyperbilirubinemia inferred via Carbon Tetrachloride 16899240
Liver Cirrhosis inferred via Carbon Tetrachloride 17174718, 16239168, 17334410, 16943688, 16221502
Liver Cirrhosis, Experimental inferred via Carbon Tetrachloride 16192424, 17525996, 17766677, 18418968, 12666154, 16638106, 18395095, 18156304, 17976157, 17557913, 17805973, 17708605, 12667390, 14748882, 13678700, 15818738, 17631135, 16097048, 15673190, 12649538, 17721639, 18277467, 18205269, 14716496, 15730626, 12632514, 15052691, 12632512, 14716833, 16136751, 17481882, 17900296, 15123356, 18339082, 18429990, 12546737, 18006644, 17640975, 18412020, 17714472, 14512876, 12609069, 18166357, 17922224, 18420326, 15876570, 18376398, 12389079, 18187930, 18210741, 16015684, 12741479, 14724832, 18472094, 15931870, 17698563, 15893842, 12958196, 12445421, 12445418, 15959796, 12898905, 18317297, 17761835, 14620537, 18472332, 18481824, 15057751, 12586293, 18054572, 10355542, 16011737, 18251166, 17823541, 17944888, 18395914, 18279442, 16027843, 15996030, 16033810, 17565644, 17869086, 16248980, 16116963, 15925388
Liver Diseases inferred via Carbon Tetrachloride 16246199, 16964402, 15830285, 15720792, 17285989
Liver Failure inferred via Carbon Tetrachloride 15123358
Liver Failure, Acute inferred via Carbon Tetrachloride 14706259, 16899240
Liver Neoplasms, Experimental inferred via Carbon Tetrachloride 15583823
Kidney Diseases inferred via Cadmium Chloride 16962696
Cell Transformation, Neoplastic inferred via Cadmium 17332340
Kidney Diseases inferred via Cadmium 16962696, 16322080
Prostatic Neoplasms inferred via Cadmium 17075824
Breast Neoplasms inferred via bexarotene 16818667, 16344269
Carcinoma, Non-Small-Cell Lung inferred via bexarotene 16247446
Lung Neoplasms inferred via bexarotene 17849452
Lymphoma, T-Cell, Cutaneous inferred via bexarotene 11161223
Mammary Neoplasms, Experimental inferred via bexarotene 15591091
Hepatitis, Toxic inferred via Acetaminophen 2444490, 16081117, 17522070, 15968718, 16227642, 16177239, 14986274, 17562736
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215
Carcinoma, Hepatocellular inferred via (2E,4E,6E,10E)-3,7,11,15-tetramethyl-2,4,6,10,14-hexadecapentaenoic acid 17261273
Leukemia-Lymphoma, Adult T-Cell inferred via (2E,4E,6E,10E)-3,7,11,15-tetramethyl-2,4,6,10,14-hexadecapentaenoic acid 16546985
Cholestasis, Intrahepatic inferred via 1-Naphthylisothiocyanate 10220858
Hepatitis, Toxic inferred via 1-Naphthylisothiocyanate 17522070
Liver Diseases inferred via 1-Naphthylisothiocyanate 17184895

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Omi S, et al. (2008) "Contribution of peroxisome-specific isoform of Lon protease in sorting PTS1 proteins to peroxisomes." J Biochem. 143(5):649-660. PMID:18281296
  2. [ + ] Lu Y, et al. (2008) "Multiple genetic variants along candidate pathways influence plasma high-density lipoprotein cholesterol concentrations." J Lipid Res. 49(12):2582-2589. PMID:18660489
  3. [ + ] Carrozzo R, et al. (2008) "Peroxisomal acyl-CoA-oxidase deficiency: two new cases." Am J Med Genet A. 146A(13):1676-1681. PMID:18536048
  4. [ + ] Ferdinandusse S, et al. (2007) "Clinical, biochemical, and mutational spectrum of peroxisomal acyl-coenzyme A oxidase deficiency." Hum Mutat. 28(9):904-912. PMID:17458872
  5. [ + ] Mehrle A, et al. (2006) "The LIFEdb database in 2006." Nucleic Acids Res. 34(Database issue):D415-D418. PMID:16381901
  6. [ + ] Olsen JV, et al. (2006) "Global, in vivo, and site-specific phosphorylation dynamics in signaling networks." Cell. 127(3):635-648. PMID:17081983
  7. [ + ] Foster LJ, et al. (2006) "Insulin-dependent interactions of proteins with GLUT4 revealed through stable isotope labeling by amino acids in cell culture (SILAC)." J Proteome Res. 5(1):64-75. PMID:16396496
  8. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  9. [ + ] Wiemann S, et al. (2004) "From ORFeome to biology: a functional genomics pipeline." Genome Res. 14(10B):2136-2144. PMID:15489336
  10. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  11. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  12. [ + ] Suzuki Y, et al. (2002) "Peroxisomal acyl CoA oxidase deficiency." J Pediatr. 140(1):128-130. PMID:11815777
  13. [ + ] Wiemann S, et al. (2001) "Toward a catalog of human genes and proteins: sequencing and analysis of 500 novel complete protein coding human cDNAs." Genome Res. 11(3):422-435. PMID:11230166
  14. [ + ] Hartley JL, et al. (2000) "DNA cloning using in vitro site-specific recombination." Genome Res. 10(11):1788-1795. PMID:11076863
  15. [ + ] Fujiwara C, et al. (2000) "Catalase-less peroxisomes. Implication in the milder forms of peroxisome biogenesis disorder." J Biol Chem. 275(47):37271-37277. PMID:10960480
  16. [ + ] Seedorf U, et al. (2000) "Sterol carrier protein-2." Biochim Biophys Acta. 1486(1):45-54. PMID:10856712
  17. [ + ] Suzuki Y, et al. (1997) "Construction and characterization of a full length-enriched and a 5'-end-enriched cDNA library." Gene. 200(1-2):149-156. PMID:9373149
  18. [ + ] Fan CY, et al. (1996) "Hepatocellular and hepatic peroxisomal alterations in mice with a disrupted peroxisomal fatty acyl-coenzyme A oxidase gene." J Biol Chem. 271(40):24698-24710. PMID:8798738
  19. [ + ] Chu R, et al. (1995) "Overexpression and characterization of the human peroxisomal acyl-CoA oxidase in insect cells." J Biol Chem. 270(9):4908-4915. PMID:7876265
  20. [ + ] Watkins PA, et al. (1995) "Distinction between peroxisomal bifunctional enzyme and acyl-CoA oxidase deficiencies." Ann Neurol. 38(3):472-477. PMID:7668838
  21. [ + ] Varanasi U, et al. (1994) "Isolation of the human peroxisomal acyl-CoA oxidase gene: organization, promoter analysis, and chromosomal localization." Proc Natl Acad Sci U S A. 91(8):3107-3111. PMID:8159712
  22. [ + ] Maruyama K, et al. (1994) "Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides." Gene. 138(1-2):171-174. PMID:8125298
  23. [ + ] Aoyama T, et al. (1994) "Molecular cloning and functional expression of a human peroxisomal acyl-coenzyme A oxidase." Biochem Biophys Res Commun. 198(3):1113-1118. PMID:8117268
  24. [ + ] Fournier B, et al. (1994) "Large deletion of the peroxisomal acyl-CoA oxidase gene in pseudoneonatal adrenoleukodystrophy." J Clin Invest. 94(2):526-531. PMID:8040306
  25. [ + ] Pacot C, et al. (1993) "Biochemical properties of liver peroxisomes from rat, guinea pig and human species and the influence of hormonal status on rat liver acyl-CoA oxidase mRNA content." Biochimie. 75(3-4):235-242. PMID:8507686
  26. [ + ] Singh H, et al. (1992) "Peroxisomal beta-oxidation of branched chain fatty acids in human skin fibroblasts." J Lipid Res. 33(11):1597-1605. PMID:1464743